ID: 1142619380

View in Genome Browser
Species Human (GRCh38)
Location 17:1154999-1155021
Sequence GGCCCCCAGGGCGCCCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 410
Summary {0: 1, 1: 1, 2: 2, 3: 36, 4: 370}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142619380_1142619385 -8 Left 1142619380 17:1154999-1155021 CCTTCCCGGGCGCCCTGGGGGCC 0: 1
1: 1
2: 2
3: 36
4: 370
Right 1142619385 17:1155014-1155036 TGGGGGCCAGCCAGTCACACTGG 0: 1
1: 0
2: 0
3: 15
4: 200
1142619380_1142619392 23 Left 1142619380 17:1154999-1155021 CCTTCCCGGGCGCCCTGGGGGCC 0: 1
1: 1
2: 2
3: 36
4: 370
Right 1142619392 17:1155045-1155067 TGTGGTCGCCTCGATGCCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 57
1142619380_1142619386 -7 Left 1142619380 17:1154999-1155021 CCTTCCCGGGCGCCCTGGGGGCC 0: 1
1: 1
2: 2
3: 36
4: 370
Right 1142619386 17:1155015-1155037 GGGGGCCAGCCAGTCACACTGGG 0: 1
1: 0
2: 1
3: 10
4: 143
1142619380_1142619389 5 Left 1142619380 17:1154999-1155021 CCTTCCCGGGCGCCCTGGGGGCC 0: 1
1: 1
2: 2
3: 36
4: 370
Right 1142619389 17:1155027-1155049 GTCACACTGGGCCCTCTCTGTGG 0: 1
1: 0
2: 3
3: 27
4: 438
1142619380_1142619393 24 Left 1142619380 17:1154999-1155021 CCTTCCCGGGCGCCCTGGGGGCC 0: 1
1: 1
2: 2
3: 36
4: 370
Right 1142619393 17:1155046-1155068 GTGGTCGCCTCGATGCCTGTGGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142619380 Original CRISPR GGCCCCCAGGGCGCCCGGGA AGG (reversed) Intronic
900101541 1:964208-964230 GGGCCCCGCGGCGCACGGGAGGG - Intronic
900104224 1:975461-975483 TGCACCCAGGGCTCCCGGGGAGG + Exonic
900176500 1:1293634-1293656 GGTCCCCCGGGCGCCCTGGCGGG - Exonic
900191506 1:1354160-1354182 GGTCCCCAGGAGGGCCGGGAGGG + Intronic
900244763 1:1631884-1631906 GGGCCCCAGGCAGCCCGGGAAGG - Intergenic
900353424 1:2248128-2248150 GGCCCCTAGGGCTCTGGGGAAGG - Intronic
900366737 1:2314713-2314735 GGCCCCCAGTGCCCCCGGACTGG - Intergenic
900482226 1:2904903-2904925 GGCCCCGAGTGCTCCTGGGAGGG + Intergenic
900523441 1:3117045-3117067 TGCCCCCAGGACCCACGGGAAGG + Intronic
900591198 1:3460812-3460834 GGCCCCCACGCTGGCCGGGAGGG - Intronic
901144467 1:7055783-7055805 GGCCCCCAGTGTGCCTGGGCAGG - Intronic
902290397 1:15431312-15431334 TGCCCCCAGGTGGCCAGGGATGG + Intergenic
902513613 1:16978871-16978893 GGCCCCCAGAGCGGCCAGGCCGG + Intronic
902870623 1:19311852-19311874 GAGCCCCAGGCCGCCCAGGATGG + Exonic
903180764 1:21603703-21603725 AGGCCCCAGGGCGTGCGGGATGG - Intronic
903986919 1:27235047-27235069 GGCCCCCAGGCCGGCAGGGCTGG - Intronic
904317292 1:29673723-29673745 GGGCCCCAGGATGCCCAGGAGGG - Intergenic
905169040 1:36099026-36099048 GGGCCCCAGGCAGCCCGGGCTGG + Exonic
905617255 1:39409436-39409458 GGCCCTCGGGGCGCGCGGCATGG + Intronic
906746539 1:48226002-48226024 GGCCTCCAGGGCTCTCTGGAAGG + Intronic
907268550 1:53277115-53277137 GGGCCCCAGGTCGGCCGGGGAGG - Intronic
913644608 1:120844601-120844623 GGCCCCCAGGCGGCTCGGGCCGG - Intergenic
914082128 1:144418982-144419004 GGCCCCCAGGCGGCTCGGGCCGG + Intergenic
914177031 1:145287482-145287504 GGCCCCCAGGCGGCTCGGGCCGG + Intergenic
914300008 1:146369817-146369839 GGCCCCCAGGCGGCTCGGGCCGG + Intergenic
914531759 1:148528974-148528996 GGCCCCCAGGCGGCTCGGGCCGG + Intergenic
914900857 1:151710399-151710421 GGTCGCCAGGGCGACGGGGACGG - Intronic
915075592 1:153306134-153306156 GGCCCCCAGCACCCCTGGGATGG - Intronic
919548072 1:198949048-198949070 GGCCCCCTGGGGCCCTGGGATGG + Intergenic
919764063 1:201115148-201115170 GACCCCGAAGGCGCCGGGGAAGG + Exonic
919922629 1:202175585-202175607 GGCCCCCAGGGCTTCCGGGTAGG - Intergenic
922025250 1:221743119-221743141 GGGCCCCAGGACGCCCGGCCAGG - Intergenic
922534721 1:226371303-226371325 GGCCCCCAGGGAGCTCAGAAGGG - Intronic
922765262 1:228153061-228153083 GGCCCCCAGGGAGCCAGGCCCGG - Intronic
922796351 1:228341626-228341648 AGCCACCTGGGCCCCCGGGAAGG - Intronic
922937782 1:229434481-229434503 AGCGCCCTGGGCGCTCGGGAAGG + Intergenic
924172504 1:241356933-241356955 TGCACCCAGCCCGCCCGGGAGGG - Exonic
924740654 1:246792750-246792772 ACCCCCCAGGGCGGCCGCGAGGG - Intergenic
924868916 1:248018810-248018832 GGACCCCAGGGGACCGGGGAAGG - Intronic
1063097452 10:2920974-2920996 GGCCCCCAGGTGGCCTAGGATGG - Intergenic
1065726058 10:28668846-28668868 GGGCCCCAGAGAGCCCGGGAGGG + Intergenic
1066066709 10:31766126-31766148 GGACCCCAGGGCTCTGGGGAAGG - Intergenic
1067414209 10:46091474-46091496 GGGCTCCAGGGAGCCCAGGAAGG - Intergenic
1067416376 10:46106314-46106336 GGCCGCCAGGTCGCGCGGGGAGG + Intergenic
1067434260 10:46265989-46266011 GGGCTCCAGGGAGCCCAGGAAGG - Intergenic
1067436511 10:46282792-46282814 GGCCGCCAGGTCGCGCGGGGAGG + Intergenic
1067439431 10:46300340-46300362 GGTCTCCAGGGAGCCCAGGAAGG + Intronic
1067576177 10:47409978-47410000 GGACTCCAGGGAGCCCAGGAAGG + Intergenic
1069635547 10:69922761-69922783 GGGGCCCAGGGAGCCCTGGAGGG - Exonic
1069651603 10:70053440-70053462 GGGCCCGAGGGAGCCCGGGGAGG + Intronic
1070800876 10:79243693-79243715 GCCCCCGAGGGCGCCAGGGCGGG + Intronic
1071508363 10:86246307-86246329 GGCCCTCAGGGAGCCCAGGTGGG - Intronic
1072783975 10:98268195-98268217 AGGCCCCAGGGCGCCCGGGGAGG - Exonic
1073325637 10:102642862-102642884 GGACCCCAGGACGCGGGGGAGGG + Intergenic
1074085657 10:110207724-110207746 GGCCCCCAGGGAGACCCGGCCGG - Exonic
1075698865 10:124455585-124455607 GGCTCCCAGGGAACCCGGAATGG - Intergenic
1076373923 10:129971389-129971411 GCCCCCGAGGGCGGCCCGGATGG - Intergenic
1076401724 10:130189632-130189654 GTGCCCCAGGGCCCCGGGGAAGG - Intergenic
1076850138 10:133088579-133088601 AGCCCCCAGGCCGCCCGCGGAGG + Intronic
1076881907 10:133243730-133243752 GGCTCCCAGGGCGCCCAGCTGGG + Intergenic
1076903650 10:133351834-133351856 GGCCCCCAGTGCTCCCGGCCAGG - Intronic
1076906252 10:133363040-133363062 GGGGCCCAGGGGGCCGGGGAGGG + Intronic
1077107741 11:849357-849379 TTCCCCAAGGGCGCCCGGGGCGG + Intronic
1077294750 11:1820944-1820966 GGCCCCCAGGGCCACATGGAGGG - Intergenic
1078011591 11:7576693-7576715 GGCCCCCAGGGTGCCCTGGCTGG + Intronic
1078132009 11:8620938-8620960 GGCCCACAGAGCTCCCAGGATGG - Intronic
1081672819 11:44950976-44950998 GGCCGCCGGGGCGGGCGGGATGG + Intronic
1081864461 11:46352084-46352106 GGCCTCCAGGGAGCCGAGGAGGG - Intronic
1081874861 11:46401605-46401627 AGCCCCCAGAGAGCCCCGGATGG + Intronic
1082837208 11:57659949-57659971 GGCCCCCATGGTACCAGGGATGG - Exonic
1083289103 11:61680165-61680187 GGTCCCGTGGGCGGCCGGGAGGG - Intergenic
1083299050 11:61730743-61730765 GGCTCCCAGGGCTCCGGGCAGGG - Intronic
1083623489 11:64060237-64060259 GGCCTCCTGGGCGCCCGCGTGGG - Intronic
1083749725 11:64754421-64754443 GGCCCCCAGAGAGCCCAGCACGG + Intronic
1083827634 11:65212263-65212285 GGCCTCCTGGGCGGCGGGGAGGG - Intergenic
1084313435 11:68330167-68330189 GGCCACCAGGGCTCCCCAGAAGG - Intronic
1089505177 11:118957761-118957783 GGCCCCGAGGGCGCACGGGGAGG - Intronic
1089593486 11:119560042-119560064 GGCACCCATGGCTCCCAGGAAGG + Intergenic
1090190212 11:124762125-124762147 GGTCACCAGGGGCCCCGGGAGGG + Exonic
1093262332 12:16954121-16954143 GGGCCCCAGGCAGCCCAGGAGGG + Intergenic
1096157352 12:49347918-49347940 GATCCCCAGGGGGCCGGGGAGGG + Exonic
1096691547 12:53325073-53325095 GGGCTCCAGCGGGCCCGGGAAGG - Intergenic
1097053083 12:56235253-56235275 GGCCCCCAGGAAGCCCAGCAAGG - Exonic
1097058850 12:56267457-56267479 GGACCCCAGGGCGCCCGCGAGGG - Intronic
1097175990 12:57143191-57143213 GGCCTCTAGGGCTCCGGGGATGG + Intronic
1097189073 12:57210897-57210919 GGGCCCCAGGGCATGCGGGAGGG + Intronic
1103400546 12:120640574-120640596 GGCCGCCAGGGAGCCGGGGGTGG + Exonic
1104688450 12:130806265-130806287 GGCCCCCACGGAGCCCTGGCAGG - Intronic
1104865381 12:131950296-131950318 GGCCCCCCGGGCTCCTGGGCTGG + Intronic
1104902580 12:132197392-132197414 AGCACCCAGGGGGGCCGGGAAGG + Intronic
1105024887 12:132841359-132841381 GGCCCCCGGGGCTCTGGGGAGGG + Exonic
1105210129 13:18252689-18252711 GGCCCCAAGGGAGGCCTGGAGGG + Intergenic
1112216320 13:97434316-97434338 GGCCCCCTGGGCGCCGGCGGCGG - Exonic
1113378802 13:109785535-109785557 GCCGCCCAGGGCGCCGGGCAGGG + Exonic
1113543840 13:111131240-111131262 GGCACCAAGGGAGCCCAGGAGGG + Intronic
1113711281 13:112466926-112466948 AGACCCCGGGGAGCCCGGGATGG - Intergenic
1113787251 13:113008959-113008981 GGCCCCCAGGGCTTGCGGGCGGG + Intronic
1114483221 14:23047967-23047989 GGCCCCCTGAGCGCCCGGGCTGG - Exonic
1117315025 14:54565717-54565739 GGACCCGAGGGCGCTCGGGCGGG - Intergenic
1118206517 14:63728128-63728150 GCCCCTCAGGGAGCCCGGGTGGG - Intergenic
1119399009 14:74349279-74349301 GGCCTCCAGGGCCACCGGGGAGG + Intronic
1121841902 14:97141619-97141641 GGCCACCATGGTGCCAGGGATGG + Intergenic
1121977329 14:98417374-98417396 GGCACCCACGACGCCCAGGAGGG + Intergenic
1121994646 14:98592860-98592882 GCCTCCCACGGCGCCCAGGAGGG - Intergenic
1122719624 14:103715137-103715159 GGCCCCCGGTGCGCGCGGGGAGG - Intronic
1122836888 14:104434906-104434928 GGCCCCCAGGGTGCAAGGGAGGG + Intergenic
1122861251 14:104583283-104583305 GGGCCCCAGGGCTCCCGGAGGGG + Intronic
1122920154 14:104876648-104876670 GGCCCCCAGGCCTCCCCAGAAGG + Intronic
1123068358 14:105629221-105629243 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123092377 14:105747545-105747567 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123097955 14:105775246-105775268 GGCCTCCAGGACGACCGGGCTGG - Intergenic
1123474692 15:20581634-20581656 GGCGGCCAGAGCGGCCGGGAGGG - Intergenic
1123643319 15:22418723-22418745 GGCGGCCAGAGCGGCCGGGAGGG + Intergenic
1124685376 15:31777660-31777682 GGCCCCCAGGCAGCCAGGCAGGG + Intronic
1125589344 15:40844639-40844661 GGCCTCCAGGGCACCCAGGCCGG + Exonic
1125606288 15:40941687-40941709 GGCGCCCTGGGCGCGAGGGAGGG - Intergenic
1127256478 15:57297826-57297848 GGCCCCCAGTCAGCCCGGGCAGG - Intronic
1127546795 15:60000084-60000106 AGCCCCCAGGACACTCGGGATGG + Intergenic
1128147140 15:65337945-65337967 TGCCTCCAGGGAGCCCAGGATGG - Intronic
1128529051 15:68431715-68431737 GGCACCTAAGGCGCCCAGGAGGG + Intronic
1129229530 15:74189088-74189110 GGCCTCCAGGGAGCCCCTGAGGG - Intronic
1129656601 15:77528955-77528977 GGCCCCCAGGGCCTCCTTGATGG + Intergenic
1129672292 15:77614003-77614025 GGACCCCCGGGCGGCCGGGCAGG - Exonic
1129983614 15:79897013-79897035 GGCGCCCAGGGCGCCGAGGGCGG - Exonic
1130535761 15:84783996-84784018 AGCCCCCAGGGGGCCAGGAAAGG + Exonic
1131473276 15:92714612-92714634 GGCCTCCAGGGGCCGCGGGAAGG - Intronic
1132545386 16:530712-530734 GGCCCACAGGGTGCACGGAATGG + Intronic
1132880960 16:2161506-2161528 GGCCACCTGGGCCCCCGGGCAGG + Intronic
1132904625 16:2276216-2276238 GGCCCCCAGGCCGCCAGGAATGG - Exonic
1133008971 16:2899712-2899734 GGCACCCAGGGGGCCAGGGCAGG - Intergenic
1133033399 16:3022118-3022140 GGCCCCCAGGGCCTCTAGGAAGG - Exonic
1133784597 16:8964119-8964141 GGCCCCCAGGGCCCGGGGGCAGG - Intronic
1134090693 16:11390300-11390322 GGCCCCCAGGGCCGCCCTGATGG + Exonic
1135517659 16:23149132-23149154 GGGCCCCGGGGCGTCCGGGCCGG - Exonic
1137655265 16:50153573-50153595 GGCCCTGCGGGCGGCCGGGAGGG + Intronic
1138497162 16:57415699-57415721 GGCCCCCAGAGTCCCTGGGACGG - Intronic
1138561190 16:57801995-57802017 CACCCCCAGGGCTCCCTGGAAGG - Intronic
1138591068 16:58000184-58000206 AGCCCCGAGGGCGGCCGGGCTGG + Intronic
1138651555 16:58464017-58464039 GGTCCCCAGCGCGGCCGGGAAGG - Exonic
1141649494 16:85385495-85385517 GCTCCCCAGGGCCCCCGAGAAGG - Intergenic
1142000682 16:87662594-87662616 GGCCACCAGGGGGCCAGGAAAGG - Intronic
1142061888 16:88035718-88035740 GGCCCCCAGTGTGGCCGAGATGG + Intronic
1142228239 16:88887716-88887738 GGAGCCCAGGGCACCCGGGGAGG + Intronic
1142343181 16:89537275-89537297 GGACCCCAGAGCCCCCGGGAAGG + Intronic
1142549906 17:732306-732328 GGCCCCGCGGCCGCTCGGGAGGG + Intergenic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1142619380 17:1154999-1155021 GGCCCCCAGGGCGCCCGGGAAGG - Intronic
1142812173 17:2400527-2400549 GCTCCGCAGGCCGCCCGGGAGGG + Intronic
1142877693 17:2861944-2861966 GGGCCCCAGGGAGCCAGGCATGG - Intronic
1143321343 17:6070806-6070828 GCCGCCCCGGGCCCCCGGGAAGG - Intronic
1143483891 17:7242367-7242389 GGAACCCAGGGGGGCCGGGACGG + Exonic
1144490447 17:15704331-15704353 GGGCCCCAGGGGGCCTGGGAGGG - Intronic
1144608878 17:16690804-16690826 AGGCCCCACGGCACCCGGGATGG + Intronic
1144882877 17:18439626-18439648 GGCCCCAAGGGCTCCAGGAACGG + Intergenic
1144903942 17:18625016-18625038 AGGCCCCATGGCACCCGGGATGG - Intergenic
1144910521 17:18677638-18677660 GGGCCCCAGGGGGCTTGGGAGGG + Intronic
1145128642 17:20321726-20321748 AGGCCCCACGGCACCCGGGATGG + Intergenic
1145149354 17:20504760-20504782 GGCCCCAAGGGCTCCAGGAACGG - Intergenic
1145195981 17:20895589-20895611 AGGCCCCACGGCACCCGGGATGG - Intronic
1145941413 17:28745092-28745114 TGCCCCCAGAGCGCAGGGGAAGG + Intronic
1146703303 17:34980780-34980802 CTCCCCCTGGGCTCCCGGGAGGG - Intronic
1147285764 17:39401704-39401726 GGGCCTCGGAGCGCCCGGGAGGG + Intronic
1147577887 17:41613026-41613048 GGCCCCGAGGGCTCCAGGAAAGG - Intronic
1147734300 17:42625175-42625197 GGTCCCCAGGGTACCCGGAAGGG + Intergenic
1148139327 17:45317092-45317114 GGCCCCGGGGGCGGCCGAGAAGG - Intergenic
1148549764 17:48543479-48543501 GTCCTCCAGGGCTCCCGGGCAGG + Exonic
1148867277 17:50635097-50635119 GACGGCCTGGGCGCCCGGGAGGG + Intronic
1149274498 17:55018012-55018034 TGCTCCCAGGGCTCCCAGGATGG + Intronic
1149654340 17:58302403-58302425 GGTCCCCAGGGCCCCCAGGTGGG - Exonic
1149772401 17:59331975-59331997 GTCCCCGTGGGCGCCGGGGACGG + Intronic
1149910329 17:60560627-60560649 GCCCCTGAGGGCTCCCGGGACGG - Intergenic
1150212077 17:63446865-63446887 TGCCCCCAGGGCTCCCGGAGCGG - Intergenic
1150484719 17:65535917-65535939 GCCCCCCTGGGAGCCCAGGATGG + Intronic
1151344516 17:73493406-73493428 GGGCCCCAGGGCTGCCAGGATGG + Intronic
1151529748 17:74696645-74696667 TGCCCCCCGGGGGCCCGGGAGGG - Intronic
1152345466 17:79748277-79748299 GGCACCCAGGGTGCCCCGCAGGG - Intergenic
1152566714 17:81103617-81103639 GGCCGACAGGGCGCTGGGGAGGG - Exonic
1152697770 17:81805156-81805178 GGCTCCCAGGGCGTCCGCAAGGG - Intronic
1152714368 17:81891441-81891463 GGCTCCCAGGGCGGCCGCGGCGG - Exonic
1154202459 18:12308598-12308620 GGCCGCCGGGGCGCCTGGGGTGG + Intronic
1155500054 18:26479192-26479214 GGCCGCCTGGGCGTCCGGGTGGG + Intronic
1157354007 18:46917160-46917182 GGCGCCGAGGGCGCGGGGGAGGG - Intronic
1157464210 18:47930542-47930564 GGCGGCCCGGGCGCGCGGGAGGG + Exonic
1160222068 18:76984965-76984987 TGCCACCAGGGCCCCGGGGAAGG + Intronic
1160531503 18:79567639-79567661 GGCCCCCACGGTGCCCTTGAGGG - Intergenic
1160592818 18:79953222-79953244 GGACCCCAGTGCTCCCGTGAGGG - Intergenic
1160719483 19:590940-590962 GGAACGAAGGGCGCCCGGGAAGG + Intronic
1160766974 19:813058-813080 GGGCCCCAAGGCGGCCGAGACGG - Exonic
1160776930 19:860852-860874 GGTCCCCAGGGCCGACGGGAAGG + Exonic
1160789690 19:917777-917799 GGCCCTCGGAGCCCCCGGGACGG - Intronic
1160820149 19:1054117-1054139 GGACCCCAGGGCCACTGGGAAGG - Intronic
1161072938 19:2271314-2271336 GGCCGCCCGGACGCCCTGGAGGG + Intronic
1161086693 19:2338743-2338765 GGCCCCCAGGTCCCCCCGGGGGG + Exonic
1161114483 19:2489077-2489099 CGCGCCCAGGGCGCACCGGAGGG - Intergenic
1161396491 19:4047401-4047423 AGCCCCCTGGGCACCCGGCATGG - Exonic
1161408000 19:4101191-4101213 GGCCCCCGGGGCTCTGGGGAGGG + Intronic
1161495638 19:4584423-4584445 GGCCTTCAGGGTCCCCGGGATGG + Intergenic
1161978750 19:7619886-7619908 GGTCCCAAGGGGGCCCGGGGTGG - Intronic
1162410575 19:10502919-10502941 GGCCACCACGGCGCCCAGCATGG + Intronic
1162578652 19:11514197-11514219 GGCCCCGAGGGAGCCGGCGAGGG + Exonic
1162581870 19:11536221-11536243 CGCCCCCTGGCGGCCCGGGAGGG - Intergenic
1162799529 19:13103049-13103071 GGGCCCCAGGGCAGCCGGGGAGG + Intronic
1163475472 19:17523527-17523549 GGCCCCCAGAGCGGCAGGCACGG + Intronic
1163831034 19:19547280-19547302 GGCCTCCAGGGCACCTGGGATGG + Intergenic
1165429633 19:35765160-35765182 TGGCCCCAGGGCACCCGGTAAGG + Exonic
1165858547 19:38894583-38894605 GGCCCCCAGGGCTGCTGGGAAGG - Intronic
1166048455 19:40243448-40243470 GGCCCGCAGGACTCCCTGGAGGG + Intronic
1166109696 19:40614425-40614447 GGCCCCGAGGGCACCTGTGACGG + Exonic
1166800031 19:45451036-45451058 GGCCCGCCGGGAGCCCGGGGCGG + Intronic
1167249748 19:48393595-48393617 GGTCCCCAGGGAGGCCAGGAGGG + Intergenic
1167300030 19:48672828-48672850 GGACCCCAGGCCGCCCAGGCAGG - Intronic
1167471308 19:49677681-49677703 GGCGCCCAGGGGGGCGGGGAGGG + Intronic
1167492697 19:49801509-49801531 GGCCCGCAGGACGCCCTGGATGG - Exonic
1167586553 19:50378668-50378690 GGCAGCCAGGGCTCCGGGGAAGG + Exonic
1167594531 19:50419982-50420004 GGGCCCCTGGGGGCCAGGGAGGG + Intronic
1167637101 19:50661588-50661610 GTCCCCCAGGCCGCAGGGGAAGG - Intronic
1168247045 19:55117605-55117627 GGCCCCCGGGGCGGGCGGGCGGG - Intergenic
1168251663 19:55145661-55145683 GGCCCCCAGGACCCCAGGGAAGG + Intronic
1168300364 19:55401535-55401557 GGGCCCCAGGGGGCCCGGGAGGG - Exonic
1168326367 19:55540773-55540795 AGCCCCCAGGGCCACCTGGATGG - Exonic
925082557 2:1081615-1081637 GGCACCAAGGGCAGCCGGGAAGG - Intronic
925284888 2:2709423-2709445 GGCCAACAGGGAGCCCTGGAAGG + Intergenic
927710611 2:25323431-25323453 GCCTCCCAGGGAGCCCTGGAGGG - Intronic
927937902 2:27085852-27085874 GACGCCCAGGGTGCCCGGGCTGG - Exonic
928615427 2:33033987-33034009 GTCCCCCAGGGAGCCGGGGAGGG - Intronic
929666597 2:43838600-43838622 GGCTCCCAGAGCTCCCTGGAGGG - Exonic
930198384 2:48530378-48530400 GGGCCCCAGGGCGCCCCTGGGGG - Intronic
931646259 2:64424665-64424687 GGCCCCCAGAGGGGCAGGGATGG - Intergenic
932715168 2:74095346-74095368 GGAGCCCAGGGGGCCCTGGAAGG + Intronic
934921373 2:98347397-98347419 GGCCCCCAGGGGCGTCGGGAGGG - Intronic
937910290 2:127072311-127072333 GGCCCCTAGGGCACCAGGGCAGG - Intronic
939127427 2:138193971-138193993 GGCCCACATGGCGCACTGGAAGG - Intergenic
941448909 2:165635183-165635205 GGCCCCTGGGGTGCCCGTGAGGG + Intronic
946308824 2:218871649-218871671 GGCCCCGCGGGCTCCCCGGAAGG + Exonic
946966426 2:225042206-225042228 GGCGCCTGGGGCGCGCGGGAAGG + Intronic
947168166 2:227283813-227283835 GGTTCCCAGGGGGCCCTGGAGGG - Exonic
947178773 2:227393687-227393709 GGCCCCCAGAGCTCCAAGGAAGG - Intergenic
947549652 2:231037429-231037451 GGACCCCCGGGCCCCCGGGCGGG - Intergenic
947565501 2:231190567-231190589 GGAACCCAGGACGCCCGGGTGGG + Intergenic
947636100 2:231681342-231681364 GGCCCGGAGTGCGCCCGGGGCGG - Intergenic
948559906 2:238845914-238845936 GGCCCCGGGGACGCCCTGGAAGG - Intergenic
948627778 2:239279732-239279754 GGCCCGCAGGGGGCATGGGATGG + Intronic
948716570 2:239869364-239869386 GGACCTCAGGGCTCCCTGGAAGG + Intergenic
948728888 2:239951234-239951256 TGCCCACAGGGCGTGCGGGAGGG + Intronic
948910242 2:240999065-240999087 GGCTCGCGGGGCGCCCGGGAGGG + Intronic
1170150054 20:13220032-13220054 GGACCCCAGTGCCTCCGGGATGG - Intergenic
1170226315 20:13995364-13995386 GGGCCCCAGGGCGCACGCGCAGG - Exonic
1170827702 20:19810443-19810465 GGCTGCCAGGGCCCCCAGGAGGG + Intergenic
1170998671 20:21391725-21391747 GGCTCGCGGGGCTCCCGGGAGGG - Intergenic
1174444052 20:50578639-50578661 GCTCCCCAGGGCACCCGCGAGGG - Intronic
1174609089 20:51784415-51784437 GGCCCCCAAGGAAACCGGGAGGG + Exonic
1175256641 20:57652030-57652052 GGTCCCCAGGGGGGCCGGGCTGG - Exonic
1175429355 20:58891189-58891211 GGCCCCCCGGGAGCCCGGGGAGG - Intronic
1175972845 20:62695643-62695665 GGCCCCCAGGAGGCTCCGGATGG + Intergenic
1176084910 20:63291456-63291478 GGCCCCCTGGGAGCCCGCCACGG + Intergenic
1176086748 20:63298907-63298929 GGGCACCGGGGCACCCGGGACGG - Intronic
1178403430 21:32306236-32306258 GGACTCCTGGGCCCCCGGGAGGG - Intronic
1178922477 21:36747769-36747791 GCCCGCCAGGCCGCCCGGGACGG + Exonic
1179553722 21:42159667-42159689 GGCTCCCAGGGCCCCCTGGGGGG - Intergenic
1179935686 21:44602275-44602297 GGCTGCCAGGACGCCTGGGAAGG - Intronic
1179950804 21:44707920-44707942 GACCCCCAGGGCTCCGGGAAGGG - Intronic
1180079027 21:45477913-45477935 GACCCCCAGGGCCTCCGGGGAGG + Exonic
1180188481 21:46151786-46151808 AGCCCCCCGGGGTCCCGGGAAGG + Intronic
1180219556 21:46349558-46349580 GGGCCCGGGGGCGCCCAGGATGG + Intronic
1180766128 22:18346715-18346737 GGCCCCGAGGGAGGCCTGGAGGG - Intergenic
1180780185 22:18515663-18515685 GGCCCCGAGGGAGGCCTGGAGGG + Intergenic
1180797155 22:18611518-18611540 GACCCCCAGGGGGCGCCGGAAGG - Exonic
1180812901 22:18772984-18773006 GGCCCCGAGGGAGGCCTGGAGGG + Intergenic
1180833566 22:18918765-18918787 GACTCCCAGGCCGACCGGGAGGG + Intronic
1180901748 22:19378012-19378034 GCCCGCCAGGGAGCCCGAGAGGG + Exonic
1181022802 22:20112507-20112529 GGCTCCCAGGGCCCCAGGGGCGG - Exonic
1181199079 22:21207300-21207322 GGCCCCGAGGGAGGCCTGGAGGG + Intergenic
1181224568 22:21383753-21383775 GACCCCCAGGGGGCGCCGGAAGG + Exonic
1181254064 22:21551060-21551082 GACCCCCAGGGGGCGCCGGAAGG - Exonic
1181400683 22:22648556-22648578 GGCCCCGAGGGAGGCCTGGAGGG - Intergenic
1181648707 22:24247332-24247354 GGCCCCGAGGGAGGCCTGGAGGG + Intergenic
1181672882 22:24433955-24433977 GGAACCCAGGCCGCCTGGGAGGG - Intronic
1181808133 22:25387360-25387382 GGCCACCAGGGCTCCCCAGAAGG + Intronic
1182283740 22:29232265-29232287 GCCCCCCAGGGAGCCCTGGCCGG + Exonic
1183017258 22:34999386-34999408 GGCACCCAGGCAGCCTGGGATGG + Intergenic
1183101588 22:35587526-35587548 GGCCCCCAGTGAGCCTGAGAGGG - Intergenic
1183293874 22:37018944-37018966 GGCCCCCGGGCCGGCTGGGAGGG - Exonic
1183370149 22:37427525-37427547 GGCGGGGAGGGCGCCCGGGAGGG + Intergenic
1183622759 22:38984015-38984037 AGCCCCGAGGACTCCCGGGAGGG + Intronic
1183731548 22:39621423-39621445 GCCCCACAGGGCGCTCAGGATGG - Intronic
1184697960 22:46150374-46150396 GGCCCGGAGGGCGCGCGGGGCGG + Intergenic
1185010112 22:48308159-48308181 AACCCCCAGGGCGCCAGGCAGGG - Intergenic
1185014148 22:48333689-48333711 GGCTCCCAGGCCTCCCGGGGTGG + Intergenic
1185225178 22:49648053-49648075 GGCCCCCACAGCCCCTGGGAGGG + Intronic
1185314137 22:50171465-50171487 GGCCCCCAGTGCACCCGGAGAGG - Intronic
1185340032 22:50287080-50287102 GGCCACCCGGGGGCTCGGGAAGG + Intronic
1203227746 22_KI270731v1_random:87606-87628 GGCCCCGAGGGAGGCCTGGAGGG - Intergenic
1203283651 22_KI270734v1_random:144063-144085 GACTCCCAGGCCGACCGGGAGGG + Intergenic
950262660 3:11553984-11554006 GGCACCCAGGGCTCCCTGGAGGG - Intronic
950427350 3:12931655-12931677 GGCCCCCTGGGGGCGCTGGAAGG + Intronic
950479742 3:13236952-13236974 GCCACCCAGTGCGCCCGGGCCGG - Intergenic
950528262 3:13537167-13537189 GGCCCACAGGGAGCCACGGAGGG + Intergenic
951264891 3:20553184-20553206 GGCACCCAGGGCACCCAGGGAGG + Intergenic
953257655 3:41306193-41306215 GCCCCCCACCCCGCCCGGGAGGG + Intronic
954130313 3:48557231-48557253 GGAGCCCAGGGCCCCCAGGAGGG + Intronic
954135415 3:48580034-48580056 GTCCCCCAGGACCCCCGGGACGG - Exonic
954327148 3:49869806-49869828 GGCGCCGAGGGCTCCGGGGACGG + Exonic
954400685 3:50318001-50318023 AGCCCCCAGGAAGCCCAGGAGGG - Exonic
954432109 3:50476265-50476287 TGCCCCCAGTGCCCCCGGGTTGG - Intronic
956414568 3:69013245-69013267 GGTCCCCAGCGCGCCTGGGAGGG + Intronic
961762688 3:129183458-129183480 GGCCCCAAGGGCGCACGGGCGGG + Intronic
961825222 3:129595741-129595763 GGCCCTCAGGGCGGCCTGGCTGG - Intronic
963046253 3:141104676-141104698 GGCTCCCAGGACGCCCTGGCAGG - Intronic
966940335 3:184742031-184742053 GGCCTCCAGGGGGCCCTGGGAGG - Intergenic
968504418 4:965332-965354 GGCCCCCACGGTGCCAGGGCAGG + Intronic
968739539 4:2320311-2320333 GGCCCCCTGGGTGCCGCGGACGG + Intronic
968879586 4:3292384-3292406 GGGCCCCGGGACGCCCGCGAAGG - Intergenic
968965695 4:3768095-3768117 GGCCTCCAGGGCGCAGGGGAGGG + Exonic
969268830 4:6085172-6085194 GGGCCCCAGGGAGCCACGGAAGG - Intronic
969398868 4:6940426-6940448 CGCCCTCAGGGCTCCGGGGAAGG + Intronic
969583865 4:8080886-8080908 GGCCCCTGGGGCAGCCGGGAGGG + Intronic
975683359 4:76897372-76897394 CTCCCGTAGGGCGCCCGGGAAGG - Exonic
984024001 4:174521855-174521877 GGCACCCAGGGCCCCCTGGCCGG + Intronic
984734967 4:183099721-183099743 TGCCCCGAGGGGTCCCGGGAGGG + Intronic
984811104 4:183797369-183797391 GGGCCGCTGGGCGCCCGGGGAGG + Intergenic
985545745 5:508150-508172 AGCCCAGAGCGCGCCCGGGATGG + Intronic
985545858 5:508648-508670 AGCCCATAGCGCGCCCGGGATGG + Intronic
985576912 5:677853-677875 GGACGCCAGGGCCACCGGGAGGG - Exonic
985657726 5:1140710-1140732 GGAGCCCAGGGCCCCGGGGAGGG + Intergenic
985801654 5:2008372-2008394 GGCCCCCAGTGAGCTCCGGAGGG - Intergenic
986402469 5:7394993-7395015 GGCCCCCAAGGTGACAGGGAGGG + Intergenic
986449581 5:7851058-7851080 GGGCCCCTGGGCGGGCGGGACGG - Exonic
992039627 5:72816928-72816950 GTCCCGCAGGGCGCCTGGGCGGG - Intronic
993386507 5:87268398-87268420 GGCCCCTGGGGCTCCCGGGCGGG + Exonic
993795940 5:92267990-92268012 AGCCCCCAGGGCACCCAGGGTGG - Intergenic
997606179 5:135177175-135177197 GCCCCCCAGGGCACCAGGCAGGG + Intronic
998385250 5:141753661-141753683 GGCCCCGGGGGCTCCCGGGCTGG + Intergenic
1002487739 5:179550933-179550955 GGCCCCCACCGCGCCCGCGCCGG - Intronic
1002596727 5:180328584-180328606 GGCCCACAGGGAGCCCGGCAGGG + Intronic
1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG + Intronic
1003633599 6:7811025-7811047 GGCCCCCAGGGCCCCCACCATGG + Intronic
1003715558 6:8642323-8642345 GGCCCCCAGGGAGGCTGGTAGGG + Intergenic
1005947147 6:30602894-30602916 GGCCCCCAGGACCCCCTGGTGGG + Exonic
1006093541 6:31642203-31642225 AGCCCCCAGGGAGCCCAGCAGGG + Exonic
1008382357 6:50849607-50849629 GGCGCCCAGGGTCCCTGGGAAGG - Intergenic
1008956623 6:57222403-57222425 GCCTCCAAGGGAGCCCGGGAGGG + Intergenic
1010152988 6:72758081-72758103 GTCCCCCAGGCAGCCAGGGAAGG + Intronic
1013836719 6:114342882-114342904 GGCCCCCAGAGCGCCCGAGCCGG + Exonic
1015999653 6:139029519-139029541 GGCACCGCTGGCGCCCGGGAAGG - Intronic
1017825816 6:158081189-158081211 GGCATCCAGGGGGCCCTGGAAGG - Exonic
1017875917 6:158524201-158524223 TGCACCCAGGGCTGCCGGGAAGG - Intergenic
1017935282 6:158999835-158999857 GGTCCCCAGGTTTCCCGGGAAGG + Exonic
1019282558 7:207764-207786 GGCCTCCAGGTCGCCCGAGATGG - Intronic
1019421978 7:954791-954813 GGTCCCCGGGGCGCGCGGGCTGG - Intronic
1019494695 7:1332314-1332336 GGCCCCTAGGGAAGCCGGGAAGG + Intergenic
1019599474 7:1874079-1874101 GGCCACCGGGGATCCCGGGACGG + Intronic
1020281504 7:6652492-6652514 GACCCCCAGGCCGCCTGGGTCGG - Exonic
1021500928 7:21330660-21330682 GGCCCCCAGGGCGGCAGGCAAGG + Intergenic
1022020825 7:26398317-26398339 AACCACCAGGGCGCACGGGACGG + Intergenic
1022468566 7:30667364-30667386 GGGCACCAGGGAGCCAGGGAGGG - Intronic
1022559855 7:31336675-31336697 GGCCCCCAGGGCGCCCACTGCGG + Intergenic
1022973267 7:35536190-35536212 GGCCCCCTGGGGGCCCAGCAGGG - Intergenic
1023221132 7:37920965-37920987 GGCACCCAGGGCGCCCGGGACGG - Exonic
1023319305 7:38976076-38976098 GGGCTCCCGGGCGCCCAGGAGGG + Intergenic
1023638439 7:42236548-42236570 GGCGCGCACGGCGCTCGGGATGG - Intronic
1023842826 7:44106628-44106650 GTCCCCCAGGCCGCCCAAGAAGG + Exonic
1026848183 7:73709213-73709235 GGCCCCCAGGGAGAGGGGGAGGG - Intronic
1027390354 7:77697112-77697134 GGCGCCCACGGGGCCCGGGAAGG + Intronic
1029205336 7:98866419-98866441 AGCCCCCAGGGAACACGGGATGG - Intronic
1029205880 7:98869365-98869387 GTCCCCCAGGGAGCACGGGATGG - Intronic
1029402303 7:100353725-100353747 GGCACCCAGGAGGCCTGGGAAGG - Intronic
1029539309 7:101173433-101173455 GGCGCCCTGGGAGCGCGGGAAGG - Exonic
1029640159 7:101815649-101815671 GGCCCCGAGGGGGCGCTGGAGGG - Intergenic
1029927091 7:104329256-104329278 GGACCCCGGGGCGCCCGAGCCGG + Intronic
1034411665 7:150945413-150945435 GGCCCCCAGCTGGCCCGGTAGGG + Exonic
1035290580 7:157835619-157835641 GGCTCTCAGGGCGCTCGGGAGGG + Intronic
1035737761 8:1901145-1901167 GGTACTCAGGGCACCCGGGATGG + Intronic
1037913445 8:22757914-22757936 GGCCCCCAGGGCATCCGGCCAGG - Intronic
1038022714 8:23563576-23563598 GGGCCCCAGGGTCCCAGGGAGGG - Intronic
1038632872 8:29262754-29262776 GGGCCCGACGGCGCCAGGGACGG + Intronic
1039793810 8:40895857-40895879 GACCCCCAGGGAGCCCAGGAGGG - Intronic
1041260709 8:56018755-56018777 GGCCCCCAGGGCCCGGGGCAAGG + Intergenic
1048178341 8:132172679-132172701 GGACCCCAGGATGCCCTGGAGGG + Exonic
1049039402 8:140100603-140100625 GGCCCCAATGGTGCCCAGGAAGG - Intronic
1049796151 8:144498148-144498170 TGCCTCCAGGCCTCCCGGGAGGG - Intronic
1051287370 9:15510717-15510739 GGCCCCCTCGGCTCCCGGGCGGG + Intronic
1051404920 9:16727046-16727068 CGCCTCCAGCGCGGCCGGGACGG + Intronic
1054769517 9:69070441-69070463 GGCCACCAGGGCCACCAGGAGGG + Intronic
1057182988 9:93039859-93039881 GGCCCCCATGGCTGCAGGGAGGG - Intergenic
1059234495 9:112750685-112750707 GGCGCCGCGGCCGCCCGGGAGGG - Intergenic
1060105253 9:120869142-120869164 GGCCCCCCGGGCGGCAGGGCAGG - Intronic
1060356455 9:122913363-122913385 GGCCCTCTAGGCGCCCCGGAAGG + Intergenic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060811550 9:126613708-126613730 GGCCCGCGGGGCGGCCGGGCCGG + Intergenic
1060932060 9:127495441-127495463 GGTCCCCAGGGCTCCCTGGCCGG - Intronic
1061152647 9:128837647-128837669 GGTCCGCAGGGGGCCAGGGAAGG + Intronic
1061277324 9:129576928-129576950 AGCCCCCAGGGCGGCAGGAAGGG - Intergenic
1061295404 9:129674265-129674287 GGTCCCCATGGCGCCCTTGATGG + Intronic
1061489940 9:130939236-130939258 GGCCCCGAGGGCGCCCCCGCCGG + Intronic
1061666618 9:132163661-132163683 GGGCCCCTGGGGGCACGGGAGGG - Intronic
1061666813 9:132164830-132164852 GGGCCCCAGGGCTCCAGGCATGG - Intronic
1061816351 9:133199725-133199747 GGCCTCCCGGGAGCCAGGGACGG + Intergenic
1062147853 9:134999968-134999990 GGGCCGCAGGGCTCCTGGGATGG + Intergenic
1062274840 9:135725881-135725903 GGCTCCCAGGGCGGGTGGGAGGG - Intronic
1062351716 9:136142872-136142894 GGCTCCCCGGGGGCTCGGGAAGG + Intergenic
1062352463 9:136145801-136145823 GGCCCCCAGTGGGCCGGGGAAGG + Intergenic
1062367655 9:136218890-136218912 GACTCCCAGGGCCCCTGGGAGGG + Intronic
1062494825 9:136826790-136826812 GGCCCCCAGGTGGCTCAGGAAGG + Intronic
1062500654 9:136850598-136850620 GCCCCCAAGGGCGGTCGGGATGG + Intronic
1062536580 9:137023716-137023738 GGCCGGCAGGGGGCCCGGGAGGG + Intronic
1062584179 9:137241583-137241605 GGCGGCCAGGGCGCGCGGGGCGG + Intronic
1186190230 X:7060922-7060944 GGCGCCCAGGGCACCTGTGAGGG + Intronic
1196734746 X:118974086-118974108 GGCTCCCAGGGCTCTCGGGCTGG + Intergenic
1199780289 X:151052106-151052128 TGCCCACAGGGCCCCTGGGAAGG + Intergenic
1199985826 X:152949424-152949446 GAACCCCAGGGGGCCCGGAAAGG - Intronic