ID: 1142619799

View in Genome Browser
Species Human (GRCh38)
Location 17:1157739-1157761
Sequence ATGGTCCTGCTGATCCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142619799_1142619807 22 Left 1142619799 17:1157739-1157761 CCTGGTGGGATCAGCAGGACCAT 0: 1
1: 0
2: 0
3: 7
4: 160
Right 1142619807 17:1157784-1157806 ACAGAACCTCAGGCGCACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 153
1142619799_1142619805 12 Left 1142619799 17:1157739-1157761 CCTGGTGGGATCAGCAGGACCAT 0: 1
1: 0
2: 0
3: 7
4: 160
Right 1142619805 17:1157774-1157796 CCTGCCAGGCACAGAACCTCAGG 0: 1
1: 0
2: 3
3: 27
4: 295
1142619799_1142619801 -2 Left 1142619799 17:1157739-1157761 CCTGGTGGGATCAGCAGGACCAT 0: 1
1: 0
2: 0
3: 7
4: 160
Right 1142619801 17:1157760-1157782 ATGACCTGAGCCTGCCTGCCAGG 0: 1
1: 0
2: 4
3: 32
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142619799 Original CRISPR ATGGTCCTGCTGATCCCACC AGG (reversed) Intronic
900014483 1:138702-138724 CTGGGCCTGTTGATGCCACCGGG + Intergenic
900044348 1:493904-493926 CTGGGCCTGTTGATGCCACCGGG + Intergenic
900065755 1:728810-728832 CTGGGCCTGTTGATGCCACCGGG + Intergenic
900488409 1:2934448-2934470 ATGGCCCTGCTCACCCCACAGGG - Intergenic
900572354 1:3364871-3364893 TGGGTGCTGCTGTTCCCACCTGG + Intronic
900942876 1:5812321-5812343 CTGGTCCTGGTGATCCTGCCAGG - Intergenic
901501860 1:9657479-9657501 ATGGTCCAGCAGAGACCACCAGG - Intronic
901551831 1:10001206-10001228 CTGATCCTGCAGCTCCCACCCGG + Intronic
905327167 1:37161811-37161833 AGACTCCTGCTGATCCCTCCAGG - Intergenic
908264913 1:62368836-62368858 ATGGACATACTGATCCTACCAGG + Intergenic
908986033 1:70023217-70023239 TTGGATCTGCTGATCACACCTGG - Exonic
914785753 1:150828872-150828894 TTGTACCTGCTGCTCCCACCTGG + Intronic
915003993 1:152619954-152619976 AAGGTCATGCAGATTCCACCTGG - Intergenic
920550551 1:206856994-206857016 AGGGTCCTTCTGATACCACTAGG + Intergenic
920554152 1:206891762-206891784 AGGGTGCTACTGATCCCACAGGG - Intergenic
923039192 1:230307776-230307798 AGGGTCCTTCAGATCCCATCAGG + Intergenic
923517451 1:234709616-234709638 ATGGTGCCGCTGACTCCACCGGG + Intergenic
1064553169 10:16522109-16522131 CAGGTCCTGCTGGACCCACCTGG + Intergenic
1067166554 10:43870132-43870154 ATGGTCCTTATGATCCTCCCAGG + Intergenic
1067239217 10:44476230-44476252 TTGGTCCTCCAGATCCCACTGGG + Intergenic
1067787307 10:49259944-49259966 ATGGGCCTGCTGTTCACACTAGG - Intergenic
1069749930 10:70738784-70738806 CTGCTGCTGCTGAGCCCACCCGG - Intronic
1070985036 10:80681447-80681469 ATGGACCAGCTGGTGCCACCTGG + Intergenic
1071848602 10:89545195-89545217 GTGGTTCTGCTGATCTCAGCTGG - Intronic
1076881281 10:133240332-133240354 GCGGTCTTGCTGATCGCACCTGG + Exonic
1076970680 11:130379-130401 CTGGGCCTGTTGATGCCACCGGG + Intergenic
1079710990 11:23681089-23681111 GTGGTTCTGCAGGTCCCACCTGG + Intergenic
1081652682 11:44834937-44834959 CTGCTCTTGCTGATCCCACAGGG + Intronic
1083310621 11:61781786-61781808 TGGGCCCTGCTGAGCCCACCTGG + Exonic
1083782612 11:64925969-64925991 ATGGCCCTGCTGGTCCCCTCGGG - Intronic
1083935632 11:65868476-65868498 ACCGTCCTGCCCATCCCACCCGG + Intronic
1084432732 11:69120547-69120569 AGGGTCCTGCTGATGCCTGCTGG + Intergenic
1085255812 11:75172375-75172397 ATGGTCAGGCTGATACCACCTGG - Exonic
1085512503 11:77095490-77095512 ATGTCCCTGCTGAGCCCACTAGG + Intronic
1087159690 11:94936572-94936594 ATGGTGCCCCTGATCCCACCAGG + Intergenic
1089089702 11:115860983-115861005 ATGGTCCTGATCACCCAACCTGG + Intergenic
1101693708 12:107104889-107104911 CTGGTGCTGGTGATGCCACCTGG + Intergenic
1101900156 12:108786091-108786113 TTGTTCCTGCAGATCCCTCCTGG + Exonic
1105213340 13:18270821-18270843 ATGGCTCTGCTGCTCCCACGGGG + Intergenic
1105671991 13:22629434-22629456 ATGGCCCTGCTGATCAAAGCAGG + Intergenic
1105945204 13:25183642-25183664 ATGGGCCTTCTGTTCTCACCAGG - Intergenic
1106300484 13:28459943-28459965 AGGGTCCTTCTGATCCCCACAGG + Intronic
1110189758 13:72716839-72716861 ATGGGACTGCTGCTGCCACCAGG - Intronic
1111980958 13:95014504-95014526 AGAGACCAGCTGATCCCACCAGG - Intergenic
1117064372 14:51995438-51995460 CTGATCCTCCTGAGCCCACCTGG + Intronic
1121908477 14:97768460-97768482 CAGGTCCTGCTGATTCCAGCAGG + Intergenic
1123012618 14:105356669-105356691 GAGGTCCTGCTGATCCCTGCCGG + Intronic
1123012630 14:105356721-105356743 GAGGTCCTGCTGATCCCTGCCGG + Intronic
1123012642 14:105356773-105356795 GAGGTCCTGCTGATCCCTGCCGG + Intronic
1124955504 15:34357485-34357507 ATGGTCCCGCTGCTCCCTACTGG - Exonic
1125503832 15:40255438-40255460 AGGGTCCTGCTCATCCTCCCAGG + Intronic
1126913200 15:53436740-53436762 ATGCCCCTGCTGATGCCACATGG - Intergenic
1129374262 15:75117899-75117921 ATTGTCCTGGAGATCCAACCAGG - Intergenic
1131266792 15:90920238-90920260 CTGATCCTGCTCATCACACCAGG - Exonic
1133025493 16:2987388-2987410 ATGAGCCTGCAGACCCCACCAGG - Intergenic
1133390358 16:5405181-5405203 ATGGTCCTGGCCCTCCCACCTGG - Intergenic
1141198155 16:81877047-81877069 CTCCTCCTGCTGATCCCATCAGG - Intronic
1141652566 16:85401444-85401466 ATGGGCCTGCTGACCCCAAGAGG + Intergenic
1142329317 16:89440816-89440838 ATGTTCCTGTTGATGCCACATGG - Intronic
1142449570 16:90167104-90167126 CTGGGCCTGTTGATGCCACCGGG - Intergenic
1142457521 17:64742-64764 CTGGGCCTGTTGATGCCACCGGG + Intergenic
1142619799 17:1157739-1157761 ATGGTCCTGCTGATCCCACCAGG - Intronic
1150307347 17:64097155-64097177 AAGTTCCTGCTGATCCAAGCAGG + Intronic
1151470859 17:74316919-74316941 AGGGACCTGCTGATTCCATCAGG - Intergenic
1152225200 17:79089761-79089783 CTGCTCCTGCTCCTCCCACCGGG + Intronic
1152309497 17:79540953-79540975 TTGGGCCTGCAGATCCCCCCAGG - Intergenic
1153503524 18:5771825-5771847 CTGGTCGTGCTTATCCCTCCTGG - Intergenic
1153944138 18:10003949-10003971 GAGGTGCTGCAGATCCCACCAGG - Intergenic
1154947691 18:21178372-21178394 ATGGGTATGCTGATCCCAACAGG - Intergenic
1160265983 18:77341118-77341140 GTGGTCCTCTTGATCACACCAGG - Intergenic
1160565299 18:79783249-79783271 CTGGCCCTGCTGCTCCCGCCCGG + Intergenic
1160842050 19:1150597-1150619 ATCATCCTGCTTATCCCAGCAGG + Intronic
1160880324 19:1316671-1316693 AGGGGCCGGCTGAACCCACCAGG - Intergenic
1161948525 19:7454086-7454108 ATGGTGCTGCTAATCCCATATGG - Intronic
1162549472 19:11350680-11350702 CTGGCCCAGCTGATCCCAACAGG - Intronic
1162818672 19:13210260-13210282 CTGGTCCTGCAGCTCCTACCTGG - Intronic
926459468 2:13110987-13111009 CTGGTCCTTCTGATCTCACAGGG - Intergenic
939320577 2:140615183-140615205 ATGGACCAGCTGGTGCCACCTGG + Intronic
940694132 2:156958490-156958512 TTGGGCCTGCTGGGCCCACCAGG + Intergenic
940843446 2:158612579-158612601 ATGCTCCTACTGATAGCACCTGG + Intronic
941163070 2:162056920-162056942 TTGGACCTGCTGACTCCACCTGG + Intronic
945979761 2:216299780-216299802 ATGGTTCTGCTGATCTGACTTGG + Intronic
947639963 2:231701767-231701789 ATGCTCCTTCAGATCCCTCCAGG - Intergenic
947662771 2:231882364-231882386 AGGGTGCAGCTGCTCCCACCTGG + Intergenic
1171356055 20:24546424-24546446 ATTGTTCTGCTGGTCTCACCTGG + Intronic
1171446359 20:25207263-25207285 GTGGGCCTGCTGACCCCACCGGG - Exonic
1174140755 20:48412036-48412058 ATGATCCTGCTGATCGAAGCAGG + Intergenic
1175691099 20:61066528-61066550 ATGGTTCTTCTCATCCCACCAGG + Intergenic
1175795354 20:61767324-61767346 AGGGCCCTGCTGCCCCCACCGGG + Intronic
1176220323 20:63966600-63966622 ATGGGCTTGCTGACCCCAACAGG + Exonic
1176368575 21:6048919-6048941 ATGATCCAGCTCCTCCCACCAGG - Intergenic
1177150118 21:17446683-17446705 ATGGTCTTGGTGTTCCCTCCTGG - Intronic
1179754944 21:43489623-43489645 ATGATCCAGCTCCTCCCACCAGG + Intergenic
1179903448 21:44406866-44406888 GGGGTCCTGCGGTTCCCACCTGG + Intronic
1180184626 21:46133351-46133373 ATGGCCCGGCTGATGCCTCCAGG - Intergenic
1181289669 22:21782148-21782170 GTAGTTCTGCTGAGCCCACCTGG - Intronic
1181776798 22:25165923-25165945 AAGGAGCTGCTGAGCCCACCAGG + Intronic
1184432465 22:44449488-44449510 GTGGTTCCGCTGATCCCAACTGG - Intergenic
1185186626 22:49404796-49404818 ATGGTGCTGCTCATCACAGCGGG + Intergenic
950756880 3:15181170-15181192 ATGGTCTTGCTGATCCAACTCGG + Intergenic
952902028 3:38116981-38117003 ATGGTACTGCTGCCCCCAGCAGG - Exonic
956825485 3:72993912-72993934 ATGGTTTTTCAGATCCCACCTGG - Intronic
956850909 3:73227673-73227695 AAGGACCTGCTGAACCAACCCGG - Intergenic
958118422 3:89253106-89253128 ATGATACTTCTGATCCCAGCAGG + Intronic
960962061 3:123078330-123078352 ATGGGCCTTCTGATTCCTCCCGG - Intronic
961477878 3:127159826-127159848 CTGGTCCTCCTGACACCACCTGG + Intergenic
961823640 3:129587689-129587711 AAGGTCCTGGTGATCTAACCCGG + Intronic
963448113 3:145440540-145440562 ATGGTACTTCTGGACCCACCTGG + Intergenic
964986848 3:162752735-162752757 ATGGATCAGCTGATACCACCTGG + Intergenic
968148170 3:196317588-196317610 AAGGGCCTCCAGATCCCACCCGG + Intronic
968463882 4:740226-740248 ACGGTCCTGCCCCTCCCACCTGG + Intronic
968624026 4:1618513-1618535 CTGGCCCTGCTGTGCCCACCTGG + Intronic
968648450 4:1751161-1751183 GGGGTCCTGCTGCTCCCATCAGG + Intergenic
968668377 4:1834017-1834039 ATGGGGCTGCTGAGCCCCCCAGG - Intronic
969444568 4:7236965-7236987 AGGGCTCTGCTGAGCCCACCTGG + Intronic
971854275 4:32023889-32023911 AAGGTCCTTCTAATCTCACCTGG + Intergenic
973955157 4:56056422-56056444 ACGGTCCTGCTGGTCCCATGTGG + Intergenic
986352890 5:6896338-6896360 ATGCTCCTCCTGATCCCACAAGG - Intergenic
992212273 5:74492692-74492714 ATTCTCCAGCTGATCCCAGCTGG + Intergenic
993992445 5:94676366-94676388 CTAGTCCTGCCGATCACACCAGG + Intronic
997373873 5:133383219-133383241 AAGCACCTGCTGAGCCCACCAGG - Intronic
998928908 5:147158499-147158521 ATGGTACTGCTTATCTCACTGGG - Intergenic
1002729495 5:181325025-181325047 CTGGGCCTGTTGATGCCACCGGG - Intergenic
1005527866 6:26668983-26669005 ATGGACCAGCTGATGTCACCTGG - Intergenic
1005542930 6:26832685-26832707 ATGGACCAGCTGATGTCACCTGG + Intergenic
1007054877 6:38872930-38872952 ATGGTCCTGTGGATGCCATCTGG + Exonic
1009013746 6:57874858-57874880 ATGGACCAGCTGATGTCACCTGG + Intergenic
1013138674 6:107308790-107308812 CTGCTGCTGCTGATCCCAACAGG + Intronic
1013470621 6:110460794-110460816 AGGGTCCTGCTGGTCCCCCATGG - Intronic
1018325866 6:162668368-162668390 ATGGTTCTGTTTATTCCACCGGG - Intronic
1018357071 6:163029012-163029034 GTGCTCCTGTTGAGCCCACCTGG - Intronic
1018447089 6:163867688-163867710 ACCGTCCTGCTGATCCCGTCAGG - Intergenic
1018863854 6:167732537-167732559 ATGATGCTGCAGATTCCACCAGG + Intergenic
1020111727 7:5451539-5451561 ACGGCCCTGCGGTTCCCACCCGG + Intronic
1021608654 7:22434365-22434387 ATGACTCTGCTGATCCCACATGG + Intronic
1022061170 7:26797096-26797118 ATGGTACTTCTGGACCCACCGGG + Intronic
1023270408 7:38456112-38456134 ATGCTACTGCTGCTACCACCAGG + Intronic
1023586705 7:41738368-41738390 ATTCACCTGCTGATCACACCAGG + Intergenic
1030105040 7:105979928-105979950 AGGGTCCTGCTGAAACCAACTGG - Intronic
1030691514 7:112539793-112539815 CAGGTCCTGCTGATTCTACCTGG + Intergenic
1032491684 7:132328733-132328755 TAGGTCCTTATGATCCCACCTGG - Intronic
1034711240 7:153193210-153193232 AGGGTCCTGCTGAGCTCACAGGG + Intergenic
1035447070 7:158950372-158950394 CTGGTCCTGGTGCTCACACCTGG - Intronic
1036178933 8:6566850-6566872 ATGGCCTTGCTGATCACACATGG - Intronic
1037812836 8:22097075-22097097 ATGGTCCTGCCTCTCCCACTAGG - Intronic
1037907678 8:22725029-22725051 ATGGTCCTGCTGACCTCCCTGGG + Intronic
1038313593 8:26464578-26464600 ATGCTCCTGCTCATGACACCTGG - Intronic
1039287908 8:36062581-36062603 ATGAACCAACTGATCCCACCTGG + Intergenic
1039778037 8:40755972-40755994 ACAGGCCTGCTGTTCCCACCTGG - Intronic
1041784857 8:61620712-61620734 CAGGTACTGCTGATCCCACTAGG - Intronic
1041938934 8:63365854-63365876 ATGCACCAGCTGATGCCACCCGG + Intergenic
1044055548 8:87565755-87565777 ATGGTGCAGCTGATGCCACAGGG + Intronic
1049199378 8:141332479-141332501 AGGGACCTGCTGCCCCCACCTGG - Intergenic
1049273954 8:141710516-141710538 ATGGTCCTCCTGCTCACCCCTGG + Intergenic
1049383544 8:142329646-142329668 GTGGACCTGCTGGTCACACCTGG - Intronic
1049568809 8:143358697-143358719 ACGGTCCTGCTGCTCACCCCAGG - Intronic
1049637042 8:143694696-143694718 ATGGCTCTGCTTCTCCCACCTGG - Exonic
1053446918 9:38159666-38159688 ATGGTCCTGCTGTCACCAGCTGG - Intergenic
1056311649 9:85347236-85347258 GTGGTCCTGCTGCACTCACCTGG + Intergenic
1056445753 9:86665052-86665074 ATCTTCCTGCCGATCCAACCTGG - Intergenic
1057204486 9:93163149-93163171 ATGGCACTGCTGGTCCCACAAGG - Intergenic
1203577466 Un_KI270745v1:20294-20316 CTGGGCCTGTTGATGCCACCGGG - Intergenic
1188385217 X:29549239-29549261 ATTGTCCTGCTTGTCCTACCCGG + Intronic
1190556067 X:51637119-51637141 AAGTTCCTGCTGGTACCACCTGG + Intergenic
1191925341 X:66303124-66303146 ATGATCCTGCTGATCAAAACAGG - Intergenic
1193045083 X:77045054-77045076 ATGGTCCTTCTGATCTCAGCTGG + Intergenic
1193892755 X:87070999-87071021 TTGGTTATGCTGGTCCCACCTGG + Intergenic
1197286830 X:124605392-124605414 AAGGTCCTGTAGATCACACCTGG - Intronic