ID: 1142620091

View in Genome Browser
Species Human (GRCh38)
Location 17:1159995-1160017
Sequence AGGTGCCTTCTGGAGGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142620086_1142620091 -10 Left 1142620086 17:1159982-1160004 CCGCCGCTTGGGGAGGTGCCTTC 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1142620091 17:1159995-1160017 AGGTGCCTTCTGGAGGGAACAGG 0: 1
1: 0
2: 2
3: 33
4: 254
1142620079_1142620091 21 Left 1142620079 17:1159951-1159973 CCCTGAACTGCAGGCCTCACACG 0: 1
1: 0
2: 0
3: 30
4: 499
Right 1142620091 17:1159995-1160017 AGGTGCCTTCTGGAGGGAACAGG 0: 1
1: 0
2: 2
3: 33
4: 254
1142620080_1142620091 20 Left 1142620080 17:1159952-1159974 CCTGAACTGCAGGCCTCACACGT 0: 1
1: 0
2: 1
3: 10
4: 127
Right 1142620091 17:1159995-1160017 AGGTGCCTTCTGGAGGGAACAGG 0: 1
1: 0
2: 2
3: 33
4: 254
1142620081_1142620091 7 Left 1142620081 17:1159965-1159987 CCTCACACGTGACGCTGCCGCCG 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1142620091 17:1159995-1160017 AGGTGCCTTCTGGAGGGAACAGG 0: 1
1: 0
2: 2
3: 33
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142620091 Original CRISPR AGGTGCCTTCTGGAGGGAAC AGG Intronic
900214852 1:1475915-1475937 AGGTCCCCTCGGGAGGAAACAGG + Intronic
900222065 1:1514269-1514291 AGGTCCCCTCGGGAGGAAACAGG + Intronic
900372035 1:2336468-2336490 AGGAGCCTCCTGGAGGCAGCAGG - Exonic
900411398 1:2514301-2514323 AGGGGCCCTCTGGATGGAAGAGG + Intronic
900921234 1:5671889-5671911 AGGTGCCCTCTATAAGGAACAGG + Intergenic
901061119 1:6472357-6472379 AGGTGCCTCCTAGAGGAACCTGG - Intronic
901190679 1:7408088-7408110 AGATGCCTCCTGGACGGAGCAGG - Intronic
902276728 1:15345316-15345338 AGGTGTAGTCTGGAGGGAAGAGG + Intronic
903351166 1:22717354-22717376 AGCTGCCTTCCGGAGGGTGCAGG + Intronic
904264749 1:29311776-29311798 AGGCACCCTCTGCAGGGAACAGG - Intronic
904450204 1:30606153-30606175 AGGCCCCTTGTGTAGGGAACCGG + Intergenic
908731240 1:67228674-67228696 ATGTTCCTTCTGGAGGCTACAGG + Intronic
909451883 1:75806676-75806698 AGGTGGCTTGTGGAGGGTACAGG - Intronic
909858644 1:80575069-80575091 AGGTGCTTGCTGAAGGGAAGGGG - Intergenic
911539665 1:99143800-99143822 AGGTGCCTACTGGAGGGAGAAGG - Intergenic
912257172 1:108072085-108072107 AACTGCCTTCTGGAGTGGACAGG - Intergenic
912450309 1:109764151-109764173 AGGTGCCTACTCTGGGGAACAGG + Intronic
915843685 1:159239665-159239687 AGCTGCCTTCTAAAGGGGACTGG - Intergenic
916076957 1:161206613-161206635 AGGAGCCTTTTGGCGGGATCTGG + Intronic
916266894 1:162899008-162899030 ATCTGACTTCTGTAGGGAACAGG - Intergenic
916850353 1:168696876-168696898 AGGTACTTTCTGGAGGCAGCAGG - Intronic
917644907 1:177020341-177020363 TGTTGCCTTCTGGAGGCACCCGG + Intronic
919012543 1:191983611-191983633 AGGTGCATTCTGTTGGGAGCTGG + Intergenic
919991209 1:202709692-202709714 AGGGGCCATCTGGAAGCAACGGG - Intronic
920388130 1:205582155-205582177 AGGTCTCTCCTGGAAGGAACGGG - Intronic
923227137 1:231948728-231948750 AGGGGCATTCTGGAGGAATCTGG + Intronic
923767512 1:236906080-236906102 ACATGCCTTCTGTAGGGAAATGG + Intergenic
924694072 1:246381943-246381965 AGGTGTCAGCTGGAGGGATCTGG - Intronic
1064480886 10:15739556-15739578 AGGTTGCTTCTGGGGGGAAATGG + Intergenic
1065164342 10:22959122-22959144 AGTTACCTTCTGGAGCGAGCTGG - Exonic
1070732971 10:78844253-78844275 AGGTGCCTTTTGAAGGAAATTGG + Intergenic
1073111284 10:101064455-101064477 AGGGTCCTTCTGGAGGGCCCTGG - Intronic
1075702654 10:124479197-124479219 AGGGGCCTTCTGCAGGGTCCTGG - Intronic
1076857751 10:133125908-133125930 CAGTGCCTTGTGGAGGGCACTGG - Intronic
1078335893 11:10462884-10462906 ATGGGCCTTCTGGAAGAAACTGG - Intronic
1079153797 11:17925404-17925426 AGAAGCCTTCTGGAGGGCAAAGG + Intronic
1080076873 11:28159473-28159495 AGGTGCTTGCTGAAGGGAAAGGG + Intronic
1080258871 11:30323656-30323678 AGGTGCCCACTGGACGGATCTGG + Intronic
1080592321 11:33735158-33735180 CTGTGCCTTCTTCAGGGAACTGG + Intronic
1081858760 11:46320260-46320282 AGGAGGCTTCGGGAGGGCACTGG - Exonic
1083968311 11:66056821-66056843 AGCTGCCTACGGGAGGGAAGTGG - Exonic
1085058901 11:73426487-73426509 AGGTGCCTTCAGAAGGAACCAGG - Intronic
1085458929 11:76681534-76681556 AGGGGGCTTCTGGAGGGCAAAGG - Intergenic
1085522504 11:77146729-77146751 ACCTGCCTTCTGGGGGGAAAGGG - Intronic
1085620215 11:78032220-78032242 AGCTCCTTTCTGGAGGGAGCAGG + Intronic
1085686240 11:78624134-78624156 AGGTGCTTTCTGAAGGCAACGGG + Intergenic
1089004235 11:115077627-115077649 AGGTGTTTTCTGGAGGGAAGAGG - Intergenic
1089183314 11:116597695-116597717 AGTTGCATTCTGGAGGGGGCAGG + Intergenic
1090753752 11:129770656-129770678 AGGTGCTTGCTGAAGGCAACGGG - Intergenic
1091168215 11:133499142-133499164 CGTTGACTTCTGGAGGGAGCTGG - Intronic
1091540724 12:1458900-1458922 TGGTTCCTTCTGGTGGGAAAAGG - Intronic
1091703149 12:2677318-2677340 AGGTTCCCTCTGCAGGGACCTGG - Intronic
1092218613 12:6698742-6698764 AGGTGCCCTCTGAAGGGAGGTGG + Intronic
1096571297 12:52524751-52524773 AGGGGCCTGCTGGAGGGAAGCGG - Intergenic
1096842049 12:54385640-54385662 GGGTGGTGTCTGGAGGGAACAGG - Intronic
1097315714 12:58169188-58169210 AGGTGCCATCTGGGGTGAAATGG - Intergenic
1098467646 12:70806117-70806139 ATGTGTCTTCAGGAGGGAACAGG + Intronic
1101641215 12:106586813-106586835 AAGTGCGTCCTGGAGGGAACAGG + Intronic
1103035904 12:117656016-117656038 AGGTGCCTGCTGAAGGCAAACGG + Intronic
1106316881 13:28602112-28602134 AGGGGGCTTCTGGAGTGAAGCGG + Intergenic
1106403623 13:29454314-29454336 AGGTGTCATCTGGAGAGACCAGG + Intronic
1107601719 13:42020845-42020867 AGGTGTGTTCTTGAAGGAACAGG + Intergenic
1109516153 13:63444357-63444379 AGGTGCTTTCTGAAGGCAAAGGG + Intergenic
1111562033 13:89964539-89964561 AGGTGCATTCTGGAGTGCAGTGG + Intergenic
1113010595 13:105761546-105761568 TGGTGCCTTTGGGAGGTAACTGG + Intergenic
1113047364 13:106170293-106170315 TGGGGCTTTCTGGAGGGAACTGG - Intergenic
1113413439 13:110109945-110109967 CGGTGCCTTCTGCAGGGCCCTGG + Intergenic
1113961762 13:114130257-114130279 AGGTGACCTCTGGAGGGGAGAGG + Intronic
1114664036 14:24368195-24368217 AGGGGGCTTCTGGAGGGAGGCGG + Intronic
1116249311 14:42459583-42459605 AGGTGCTTTCTGAAGGAAAAGGG + Intergenic
1116966201 14:51017703-51017725 AGGTGCCTTCTGGAGGTAAGAGG + Intronic
1118322714 14:64762790-64762812 AGCTGCTTTCTGGAGTGACCTGG + Intronic
1120350616 14:83352873-83352895 AGGTGCTTGCTGGAGGCAAAGGG + Intergenic
1121833948 14:97075473-97075495 AGGGGCCTTTTGGAGGGTAGAGG - Intergenic
1122531122 14:102427855-102427877 AGGTGGCGTCTGGAGAGAACTGG + Intronic
1124219105 15:27834065-27834087 AGATGGCTTCAGGAGGGGACTGG + Intronic
1124613762 15:31226608-31226630 AGGCTCCTTCTGGAGGGAGTGGG - Intergenic
1124658374 15:31526314-31526336 AGGTGACTTCTGGGGAGAGCAGG + Intronic
1125438713 15:39677327-39677349 ATGAGCTTTCTGGAGAGAACAGG + Intronic
1126583141 15:50259220-50259242 AGGTGCCTTTTGCAAGAAACTGG - Intronic
1127872165 15:63082829-63082851 AGGTCCCTTCTCTAGGGAAAAGG + Intergenic
1128334024 15:66774540-66774562 GGGTGCCACCGGGAGGGAACAGG + Intronic
1128462877 15:67884633-67884655 GGGTGCCTTCTGGCGGGGGCGGG - Intergenic
1128509149 15:68302894-68302916 AGTTCCATTCTGGAGGGAGCAGG + Exonic
1128606837 15:69042808-69042830 AGGTGGCTACTGGAGGGAAGGGG + Intronic
1129217155 15:74107042-74107064 AGGTGCCTGCTGGAGGGACTGGG + Intronic
1129470692 15:75751815-75751837 AGGTGCCTGCTGGAGGGACTGGG - Intergenic
1130656713 15:85796370-85796392 AGGTGCCTTCTGAAGAGAAAAGG + Intergenic
1130894133 15:88157552-88157574 GCATGCCTACTGGAGGGAACAGG - Intronic
1131311321 15:91292919-91292941 AGGAGCTTTCTGGAGGAACCTGG - Exonic
1131883719 15:96886665-96886687 AGGTGGCTTCTGTAGGCACCTGG + Intergenic
1134317578 16:13133456-13133478 AGGAGCATTCGGGAAGGAACTGG - Intronic
1134501535 16:14772617-14772639 AGGTGGATTCTGGAGGGAGGTGG - Intronic
1135374531 16:21934303-21934325 AGGTGGATTCTGGAGGGAGGTGG - Intergenic
1135762354 16:25147431-25147453 AGGTTCCTTCAGGAGGAACCTGG + Intronic
1138415472 16:56868999-56869021 AGCTGCATTCTGGACAGAACAGG + Intronic
1138615471 16:58162034-58162056 AGGTGCCTACTGGAGGGTCTTGG - Intronic
1138630483 16:58290846-58290868 AGGTGCATTCTGGGGGGACAGGG - Intronic
1140610589 16:76593842-76593864 ATGTGCATTTTGGAGGAAACTGG - Intronic
1141284606 16:82659922-82659944 AAGTGTCTCCTGGAGGGAAAGGG + Intronic
1142283351 16:89160727-89160749 AGGTTCCTTCTGGAGGCTCCTGG - Intergenic
1142620091 17:1159995-1160017 AGGTGCCTTCTGGAGGGAACAGG + Intronic
1142849479 17:2697420-2697442 AGCTGCGTTCTGGAGGGTATGGG + Intronic
1145779613 17:27553575-27553597 AGGAGCCTGCTGGAGGTACCTGG + Intronic
1146059333 17:29596303-29596325 AGGTGCCTGGTGAAGGGAAGGGG + Intronic
1147542660 17:41373692-41373714 TGGAGCCTTCTGGAGGGTAGAGG - Intronic
1147673384 17:42189660-42189682 AGGTGGCCTCTGGGGGGAGCTGG + Exonic
1148863722 17:50617964-50617986 AGGTGCTTTCCAGAGGGAAGGGG + Intronic
1151977834 17:77492446-77492468 CTGTGCCTCCTGGAGGGAAGAGG - Intronic
1153505303 18:5790648-5790670 AGGTTCCTTCTGGAGGAAATAGG - Intergenic
1156452978 18:37277086-37277108 AGGTGGCTTGTGGAGGGCAGGGG - Intronic
1156710890 18:39944156-39944178 AGGTGATTTCGGGAAGGAACAGG + Intergenic
1156710950 18:39945005-39945027 AGGTGATTTCAGGAGGGAGCAGG + Intergenic
1157009112 18:43625062-43625084 AGGTGCTTTCTGGATGAAAGAGG - Intergenic
1157108676 18:44799297-44799319 AGGAGGCTAGTGGAGGGAACAGG - Intronic
1157289265 18:46398457-46398479 AGGTGCCTGCTGGTGGGCACAGG + Intronic
1158939115 18:62390515-62390537 AGGCCCCTTCAGGAGGGCACTGG + Exonic
1161431858 19:4237098-4237120 AGGTGCTGTCTGGAGGCAGCGGG - Exonic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1161767906 19:6217021-6217043 AGATGCCGTCTGTAGGGGACTGG - Intronic
1162184079 19:8891196-8891218 AGGTGCATTGTGGAGGTATCAGG + Exonic
1164675424 19:30097312-30097334 CAGTGACTTCTGGAGGGAAGAGG + Intergenic
1164687020 19:30173309-30173331 AGATGCCTTCTGGAGGGGCGTGG - Intergenic
1164687170 19:30174471-30174493 AGATGCCTTCTGGAGGGGCGTGG - Intergenic
1165150246 19:33756035-33756057 AGGTGCCATTTGCAGGGAACTGG - Intronic
1165421590 19:35724755-35724777 AGGTAGCTCCTGGAGGGAAGGGG - Intronic
1165729508 19:38135693-38135715 AGCTGCCTTATAAAGGGAACAGG - Intronic
1168159837 19:54502951-54502973 AGGTGAGTCCTGGAGGGAGCGGG + Exonic
1168445076 19:56404428-56404450 AGGTGCCCACTGGAGGGAGGAGG + Exonic
925295215 2:2771987-2772009 CCGTGCCTTCTGGAGGTAACTGG - Intergenic
925812352 2:7712884-7712906 CAGAGCCTTCTAGAGGGAACAGG - Intergenic
926625412 2:15085983-15086005 AGATGGCTCCTGGAGGGAAGGGG + Intergenic
929975104 2:46626096-46626118 AGGGGACTACTGGAGGGAAGAGG - Intergenic
930202583 2:48559372-48559394 AGGTGCCATCTGTGAGGAACAGG - Intronic
930357008 2:50333742-50333764 AGGTGCCTTCTGCTTGGAATAGG - Intronic
930541571 2:52713143-52713165 AGGTTCCCACTGCAGGGAACAGG + Intergenic
930858090 2:56040500-56040522 AGGTGCCTTCTGCCCTGAACTGG - Intergenic
932340105 2:70958280-70958302 AGGGGCCTGCTGGAGGGAATGGG - Intronic
933119871 2:78523118-78523140 AGGGGCCTTCTGGTGAGAGCTGG + Intergenic
934715216 2:96539061-96539083 AGGTGCCTTGGGGAGGGAGCAGG + Intronic
935234907 2:101130200-101130222 AGGAGCCTTCCGGAGGTGACTGG - Intronic
935309713 2:101771547-101771569 AGGTTCCTTTTGGAGAGAAGGGG + Intronic
936084012 2:109454284-109454306 AGGCGCTTTCTGAAGGGAAGGGG - Intronic
936084695 2:109459367-109459389 AGGCGCTTTCTGAAGGGAAGGGG - Intronic
936641480 2:114316639-114316661 AGGTGCCTGCTGAAGGTAAAGGG + Intergenic
939249604 2:139667022-139667044 ATGTGCCTTCTGTAAGGAAGAGG - Intergenic
941697723 2:168571239-168571261 AGGTGCCTTCTGCTTGGAGCTGG + Intronic
946478149 2:220028837-220028859 AGTTGCCTTCTGTAGGGGAAGGG - Intergenic
947948306 2:234125357-234125379 AGGTCCCTCCTGGAGAGACCTGG + Intergenic
948219686 2:236259734-236259756 AGGTGCCTTCACAAGGGCACAGG + Intronic
948904041 2:240969372-240969394 AGGTGGCTTCTGCAGGGGAGAGG + Intronic
1169717760 20:8639560-8639582 AGATGCCTGCTGGAGGGTTCTGG - Intronic
1171773460 20:29345305-29345327 AGGTGCCCTCTATAAGGAACAGG - Intergenic
1171815501 20:29782867-29782889 AGGTGCCCTCTATAAGGAACAGG - Intergenic
1171902879 20:30873171-30873193 AGGTGCCCTCTATAAGGAACAGG + Intergenic
1174931334 20:54818365-54818387 AGGTGCTTGCTGAAGGGAAAAGG + Intergenic
1176197095 20:63842429-63842451 AGGTGCGTCCTGGGGGGAAGAGG + Intergenic
1178281662 21:31288414-31288436 AGGTGCCATCTGTGAGGAACAGG - Intronic
1178850622 21:36209432-36209454 AGGTCCCTTCTGGAGGCCCCTGG + Intronic
1179162437 21:38909459-38909481 AGGTACCTTCGGCAGGGATCTGG - Intergenic
1179564715 21:42240044-42240066 TGGTGCCTTCTGCAGGGCACTGG + Intronic
1180066232 21:45413901-45413923 AGGAGCCTTATGGAGTGAGCTGG + Intronic
1180318947 22:11303433-11303455 AGGTGCCCTCTATAAGGAACAGG - Intergenic
1180336269 22:11579141-11579163 AGGTGCCCTCTATAAGGAACAGG + Intergenic
1180955427 22:19739217-19739239 TGGTGCCCTCTGGAGAGACCTGG - Intergenic
1181467109 22:23116212-23116234 AGGGGCCTTCTGGGGGCCACTGG + Intronic
1182679785 22:32069939-32069961 AGGAGCCTTGTGCAGGGAAAAGG - Intronic
1183706676 22:39478711-39478733 AGGTGCTCTCTGGAGGCCACTGG - Intronic
1184824964 22:46943688-46943710 ATGTGGCTGCTGGAGGGACCAGG - Intronic
951503324 3:23414825-23414847 AGGTGCCATCTGTGAGGAACAGG + Intronic
953099820 3:39812968-39812990 AGGTGCTTGTTGGAGGGAGCTGG + Intronic
953418858 3:42739492-42739514 GGGGGCCATCTGGAGGCAACGGG + Intronic
953538230 3:43792001-43792023 AGATTCCTTCTTGAGGGAACAGG + Intergenic
953582272 3:44167734-44167756 AGATGGCTTCTGGAGAGAACAGG - Intergenic
954784209 3:53081218-53081240 AGGTGCCTTCTGCAGGTAATGGG + Intronic
956228110 3:66982473-66982495 AGGAGCCTCCTGCAGGGAAGGGG + Intergenic
956702646 3:71972268-71972290 TGGTGGTTTCAGGAGGGAACTGG - Intergenic
958715327 3:97773852-97773874 AGGTGCCTGCTGAAGGCAAAGGG - Intronic
961002992 3:123386428-123386450 ATGTGCTCTCTGGAAGGAACTGG + Intronic
961006812 3:123411096-123411118 AGGAGGCTCATGGAGGGAACGGG - Intronic
961061409 3:123832039-123832061 TGGGGCATTCTGGAGGGAGCTGG + Intronic
962428925 3:135301585-135301607 AGGTGACTTCTGAAGGGCAAAGG + Intergenic
962608249 3:137050448-137050470 AGATGGCTGCTGGAGAGAACTGG + Intergenic
966440878 3:179942739-179942761 AGCTGCCTTTTGATGGGAACAGG + Intronic
968582242 4:1400519-1400541 AGGCTCCTTCAGGAGGGAGCAGG + Intergenic
968882909 4:3310309-3310331 AGGTGTCCTCTGAGGGGAACCGG + Intronic
968901844 4:3435706-3435728 GGGTGGCTTCTGGTGGGATCCGG - Intronic
968919251 4:3514270-3514292 AAGTTCTTTCTGGAGGGAGCTGG - Intronic
969495835 4:7525726-7525748 AGGTGACTGCAGGAGGGGACAGG - Intronic
969495844 4:7525766-7525788 AGGTGACTGCAGGAGGGGACAGG - Intronic
970205491 4:13651494-13651516 AGGTGCCATCTATAAGGAACGGG + Intergenic
970629566 4:17925450-17925472 AGGTGCCTGCTGAAGGGAAAGGG + Intronic
970970432 4:21976975-21976997 AGGTGCCTTTTGCAGGTCACAGG + Intergenic
971522080 4:27566693-27566715 AGGAGGCTTCTGGTGGAAACTGG + Intergenic
974343491 4:60646108-60646130 AGGTGACTTCTCAAGGGCACCGG - Intergenic
976357680 4:84138342-84138364 AGGTGCCTGCAGGGAGGAACAGG + Intergenic
978874479 4:113622439-113622461 AGATGCCTGCTGGAGGGAGCTGG - Intronic
983562389 4:169114191-169114213 TGGTTCCTTCTGGAGGCCACTGG + Intronic
983729900 4:170979693-170979715 AGGTGTCTTCTGTAGGGAATGGG + Intergenic
984583039 4:181532534-181532556 CGTTTCGTTCTGGAGGGAACAGG + Intergenic
985867560 5:2526510-2526532 ATGTGCCTTATGGAGAAAACAGG + Intergenic
985939656 5:3125124-3125146 AGGTGCCTGCAGGAGGGATATGG - Intergenic
987760127 5:22150910-22150932 TAGTGCCTTGTGGAGGGAGCCGG - Intronic
991894858 5:71384344-71384366 TAGTGCCTTGTGGAGGGAGCCGG - Intergenic
993311056 5:86332358-86332380 AGGTGCCTTCATGATGGGACTGG + Intergenic
993817873 5:92575495-92575517 AGGTTCCTTCTGCAGGTAACGGG + Intergenic
998390281 5:141783047-141783069 AGGAGCCCTCTGGAGGCTACAGG - Intergenic
999192469 5:149758599-149758621 AGGTGCCATCTTTTGGGAACAGG + Intronic
999208877 5:149870466-149870488 TGGTGGCTTCAGGAGGGCACTGG + Intronic
1000591111 5:163158434-163158456 AGGAGACTTCTGGAGGGAAAAGG + Intergenic
1001548700 5:172586866-172586888 AGCTGCCCTCTGGAGGGTGCGGG + Intergenic
1002212166 5:177605540-177605562 AGGTGAGTTGTGGAGGGAACTGG - Intronic
1004514260 6:16308428-16308450 AAGTGCCTTCAGGAGAAAACAGG - Intronic
1004579165 6:16931465-16931487 TGGTGCCTTTTGGAGGGAGGAGG + Intergenic
1005306720 6:24521135-24521157 AGGTGCCCTCTACAGGGCACAGG + Intronic
1005724356 6:28634385-28634407 AGGTAGCTTCTGGAGGGCAGAGG + Intergenic
1006117897 6:31785009-31785031 ATGTGCCATCTGGAGGAATCTGG + Intronic
1007493075 6:42239576-42239598 ATGTTCCATCTGGAGGGAAATGG + Intronic
1007797432 6:44361417-44361439 AGGTGCCATGTGGATGGCACTGG + Intronic
1008303319 6:49869960-49869982 AGGTGCCATCTATAAGGAACAGG + Intronic
1009513941 6:64590080-64590102 AGGTGCCTTCTCAATTGAACTGG + Intronic
1013555870 6:111256843-111256865 GGGTGACCTCTGGAGGCAACTGG + Intergenic
1014546287 6:122740277-122740299 AGGAAGCTTTTGGAGGGAACGGG + Intergenic
1016073687 6:139771602-139771624 AGGTGCCTTCTCTACTGAACTGG - Intergenic
1016247059 6:141995089-141995111 ACATGCCTTCTGGAGGGGTCTGG + Intergenic
1017141224 6:151191759-151191781 TGCTTCCTTCTGGAGGGAACTGG + Intergenic
1017388315 6:153911207-153911229 AGGTGCTTTCTGAAGGCAAAGGG - Intergenic
1017767356 6:157617430-157617452 AGTTGGCTTCTCAAGGGAACTGG + Intronic
1018714453 6:166521093-166521115 AGTTGCCTTCTGGAGGGAGCAGG + Intronic
1018909275 6:168092616-168092638 AGGTGCCGTCTGCAAGGAAGCGG + Intergenic
1019075362 6:169382926-169382948 AGGGGCCTTCTGGAGGAAGAGGG + Intergenic
1019746461 7:2702926-2702948 AGGCCCCTTCTGGAAGGAAGAGG + Intronic
1020870910 7:13627947-13627969 AGGTGCTTTCTGAAGGCAAAGGG - Intergenic
1021616047 7:22504290-22504312 TGCTGGCTTCTGGAAGGAACTGG + Intronic
1022925840 7:35055493-35055515 TGCTGGCTTCTGGAAGGAACTGG + Intergenic
1024508676 7:50185271-50185293 CTGTGCCTGCTGCAGGGAACAGG - Intergenic
1027686071 7:81279894-81279916 AGGTGCTTCCTGGAGGCAAAGGG + Intergenic
1028238143 7:88385082-88385104 AGGTGCTTGCTGGAGGCAAAGGG + Intergenic
1028376425 7:90150052-90150074 TGCTGGCTTCTGGAAGGAACTGG - Intergenic
1029823846 7:103170186-103170208 TGCTGGCTTCTGGAAGGAACTGG + Intergenic
1030832939 7:114249367-114249389 TGGGGCCTACTGGGGGGAACGGG - Intronic
1031768023 7:125805620-125805642 AGGTGCCTGCTGAAGGTAAAAGG + Intergenic
1032740368 7:134732516-134732538 AGGTGCCATCTATAAGGAACAGG + Intergenic
1033392536 7:140941367-140941389 AGGTGCCTGCTGAAGGCAAAAGG + Intergenic
1033428419 7:141266255-141266277 AGGTGGCTTCTGAAGGCACCTGG - Intronic
1034497955 7:151433282-151433304 AGGTGCGGTGGGGAGGGAACGGG + Intronic
1035126647 7:156612549-156612571 AGGGGCTTGCTGGAGGGAGCCGG + Intergenic
1035455896 7:159008407-159008429 GAGTGCCTGCTGGAGGGAGCCGG + Intergenic
1035870924 8:3135375-3135397 AGGTACCTTCTTAAAGGAACTGG + Intronic
1036504093 8:9339512-9339534 ACGTGGCTTCTGGAGGGCAAGGG - Intergenic
1037376381 8:18234432-18234454 AGGTGCCTACTGTAGGAAAAGGG + Intergenic
1037898448 8:22673740-22673762 AGGTACCCACTGGAGAGAACTGG + Intergenic
1037998488 8:23370252-23370274 AGGTGCCATTTGGAGGGGAGGGG - Intronic
1038199080 8:25395098-25395120 AGGTCCCTTCTAGAGGTAATGGG + Intronic
1040287769 8:46109211-46109233 TGGGGCCTTCTGGATGGAAGAGG + Intergenic
1041628483 8:60058569-60058591 GGGTAGCTTCTGGAGGGACCAGG - Intergenic
1041654777 8:60337702-60337724 AGGTACCTTATGGAGAAAACGGG - Intergenic
1042567562 8:70127994-70128016 ATGTGCCTTCTGGAGAAAACAGG + Intronic
1044719136 8:95128992-95129014 ATGTGCCATCTGTAAGGAACAGG - Intergenic
1048131834 8:131706164-131706186 AGGAGCCTTCTGGAGCCAACAGG - Intergenic
1048465984 8:134665133-134665155 AGCTGCCTTCTGGAAGGAGTTGG - Intronic
1049662294 8:143824863-143824885 AAGTGTCTTCAGGAGAGAACTGG - Intronic
1049725412 8:144143405-144143427 AGGGGCCTGCTGGGGGGCACTGG + Intergenic
1055713868 9:79095805-79095827 AGGTTCCTTCTGGAAGGACAAGG - Intergenic
1056106158 9:83348810-83348832 AGGTGACTTTGGGAGGGAGCAGG - Intronic
1056663118 9:88559163-88559185 AGGTGGCCTCTGGAGGGATGGGG + Intronic
1057227023 9:93297836-93297858 AGGTGCCTGCAGGAGGGGACAGG - Exonic
1059362869 9:113759424-113759446 AGGTGCCTTCTGAGGGAAAAGGG - Intergenic
1061631527 9:131875116-131875138 GGGTGCCTTCTGGAGATCACTGG + Intronic
1061662781 9:132141390-132141412 TGATTCCCTCTGGAGGGAACTGG + Intergenic
1062113817 9:134796935-134796957 AGGTGGGTTTTGGAGGGGACAGG - Intronic
1062135854 9:134927608-134927630 AGGTGCCTGCTGAAGGCAAAGGG + Intergenic
1185625583 X:1479177-1479199 AGGTTACTTCTGAAGGGAAGTGG - Intronic
1186195678 X:7108511-7108533 AGGGGTCTTCTGCAGGGAAGAGG - Intronic
1188418958 X:29972977-29972999 AGTAGCCTCCTGGAGGGAGCAGG - Intergenic
1188642218 X:32520632-32520654 AGGTTACTGCTGGAAGGAACTGG - Intronic
1189063674 X:37782746-37782768 AGATGTCTTCTGGAGGCAAGAGG - Intronic
1189170007 X:38900102-38900124 AGGTGCCATCTAGGAGGAACAGG + Intergenic
1189175859 X:38956418-38956440 AGTTGGCTTCTGGAGGAAGCTGG + Intergenic
1190100326 X:47518041-47518063 AGGTGGGTTCTGGGGGGAAAAGG - Intergenic
1191852981 X:65599759-65599781 ATCTGCCTTCTGGAGGGCAGAGG + Intronic
1191940998 X:66481929-66481951 AGGTGCCTGCTGAAGGCAATGGG - Intergenic
1193833218 X:86312048-86312070 AGGTGCTTGCTGAAGGCAACAGG + Intronic
1193905424 X:87237967-87237989 AGGTGCTTGCTGAAGGCAACGGG - Intergenic
1193986028 X:88241498-88241520 AGGGGCCTTTTGGAGGGTGCAGG + Intergenic
1194163692 X:90487738-90487760 AGGTGCTTCCTGGAGGCAAAGGG - Intergenic
1198110193 X:133496143-133496165 CGGCTCCTTCTGGAGGGAGCAGG + Intergenic
1199708128 X:150448923-150448945 AGCTGCCTTATGAAGGGAATAGG - Intronic
1200509956 Y:4065558-4065580 AGGTGCTTCCTGGAGGCAAAGGG - Intergenic
1201565167 Y:15358139-15358161 AGGTGCTTGCTGGGAGGAACAGG + Intergenic