ID: 1142621607

View in Genome Browser
Species Human (GRCh38)
Location 17:1168967-1168989
Sequence CAGCCACCTTGACTTGGTCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142621607_1142621610 -9 Left 1142621607 17:1168967-1168989 CCTCGACCAAGTCAAGGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1142621610 17:1168981-1169003 AGGTGGCTGTTCCACGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 88
1142621607_1142621614 6 Left 1142621607 17:1168967-1168989 CCTCGACCAAGTCAAGGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1142621614 17:1168996-1169018 GCGGCTGGGTGGACGCCAGCTGG 0: 1
1: 0
2: 0
3: 11
4: 173
1142621607_1142621611 -8 Left 1142621607 17:1168967-1168989 CCTCGACCAAGTCAAGGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1142621611 17:1168982-1169004 GGTGGCTGTTCCACGCGGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 61
1142621607_1142621612 -5 Left 1142621607 17:1168967-1168989 CCTCGACCAAGTCAAGGTGGCTG 0: 1
1: 0
2: 0
3: 8
4: 65
Right 1142621612 17:1168985-1169007 GGCTGTTCCACGCGGCTGGGTGG 0: 1
1: 0
2: 1
3: 10
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142621607 Original CRISPR CAGCCACCTTGACTTGGTCG AGG (reversed) Intronic
903181261 1:21606071-21606093 CAGCCGCCTTGGCCAGGTCGGGG + Exonic
905208354 1:36356036-36356058 CAGCCACCTTGTCTTAGCTGTGG + Intronic
905946106 1:41902471-41902493 CAGCCACCTTGCCCTGGCAGTGG - Intronic
912567611 1:110599561-110599583 GAGCCACCTTTACTTGCTTGTGG - Intronic
913537900 1:119791703-119791725 CAGCCACCTTGCATTAGACGGGG + Intergenic
915591763 1:156874896-156874918 CAGCCACCGAGACCTGGTGGGGG - Exonic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
923688074 1:236167808-236167830 CAGCCTCCTTGTCTGGGGCGTGG + Intronic
924780418 1:247142031-247142053 CAGCCACCCTGACTTGTGCCAGG + Intronic
1068360282 10:55968535-55968557 CAGCCTCCTTCATTTGATCGAGG + Intergenic
1069606889 10:69744352-69744374 CAGCCACCTTCAATGGGTCATGG + Intergenic
1077244560 11:1529893-1529915 CAGCCACCTTCTGTTGGTCAGGG - Intergenic
1079782264 11:24622442-24622464 CAGCCTGCTTGCCTTGGCCGTGG + Intronic
1081769733 11:45642239-45642261 CAGCTTCCTTGACTGGGTCTGGG - Intergenic
1084472093 11:69368411-69368433 CAGCCACCCTGACTTGCCCAGGG - Intergenic
1096500665 12:52062269-52062291 CAGCCACCTGGTCTTGGTTATGG + Intergenic
1113466222 13:110515049-110515071 CAGCCATCCTGACTGGGTAGGGG + Intergenic
1116817688 14:49598986-49599008 AAGCCAGCTTGACGTGGTTGTGG + Exonic
1126692205 15:51296348-51296370 CTGCCACCTTGACTTGGGAGAGG - Intronic
1130101298 15:80896038-80896060 CTGCCACTTTGACCTGGTTGGGG - Exonic
1142621607 17:1168967-1168989 CAGCCACCTTGACTTGGTCGAGG - Intronic
1150077066 17:62201610-62201632 CAGCCATCTTGACTGGTCCGTGG + Intergenic
1151843193 17:76632295-76632317 CAGGCACCTTAACTTGGCCGTGG + Intronic
1152720714 17:81922655-81922677 CGGCCACCTTGCCTGGGACGAGG + Exonic
1156005610 18:32437635-32437657 GAACCACCTTGACTTTCTCGGGG - Intronic
1159466790 18:68794267-68794289 CAGCCTCCTTGTCTTGTTCAAGG + Intronic
1163277830 19:16296668-16296690 CAGCCTCCGTGACTTGCCCGAGG + Intergenic
1165050412 19:33137949-33137971 CAGCCACCCTAACTTCGTCTAGG - Intronic
926772492 2:16390958-16390980 CAGCCACCTTGACAAGGGCAAGG + Intergenic
933042482 2:77487230-77487252 CAGCCACCCAGCCCTGGTCGTGG + Intronic
935707600 2:105870291-105870313 CAGCCACCCTGCCTGGGTGGGGG - Intronic
941286452 2:163619391-163619413 CAGGCACCATGACTTGGACTAGG + Intronic
941636022 2:167935716-167935738 CTGCCAACTTGACTGGGTCGTGG + Intergenic
946029696 2:216694436-216694458 CACCGATCTTGACTTGCTCGCGG + Exonic
1169697060 20:8401821-8401843 CAGCCTCCTTGAATTGGGCTGGG - Intronic
1170906219 20:20517120-20517142 CAGCCACCGTGAATTGTTCCAGG - Intronic
1173064850 20:39700522-39700544 CAGTCACCTTAAGTTGGTCATGG + Intergenic
1175593908 20:60215173-60215195 CAGCCAGCTTTCCTTGGTCAGGG + Intergenic
1176144607 20:63559961-63559983 CAGCCACATTCACTTGGTTGGGG + Exonic
1179493469 21:41756518-41756540 CCCCCACCTTGACGTGGTAGTGG + Exonic
1180061059 21:45385318-45385340 CTGCCACCATGACTTGGCCATGG - Intergenic
949520614 3:4850274-4850296 AAGCCACCTTGATTGGGCCGAGG - Intronic
950569335 3:13790544-13790566 GAGCCACTTTGACTAGGTCTGGG - Intergenic
950659032 3:14455270-14455292 CTGCCACACTGACTTGTTCGGGG - Intronic
951938469 3:28050799-28050821 CAGCCTCCTATACATGGTCGGGG + Intergenic
954238563 3:49275855-49275877 CAGGCACCTTGACTTGGAGAAGG - Intronic
957114783 3:76011249-76011271 CAGCCACCTTGAAGTGATCGCGG - Intronic
965148984 3:164945857-164945879 CAGCCACCTTTCCTTGGTCTTGG - Intergenic
966250594 3:177860646-177860668 CACCCACCTTGGCTTGGGGGAGG + Intergenic
983105805 4:163684139-163684161 AAGCCACCTTCAGTTGGTCAAGG + Intronic
989179260 5:38560024-38560046 CAGCAACCTTGAGTTGATGGTGG + Intronic
993430604 5:87828041-87828063 CAACCATCTTGAATTGGTCCTGG - Intergenic
997591288 5:135074166-135074188 CAGCCAGCTTGACGCGGCCGGGG - Intronic
998101522 5:139439117-139439139 CAGTCACCTTGGCATGGGCGGGG + Intronic
998106149 5:139470765-139470787 GAGCCAGCATGACTTGGTGGGGG + Intergenic
1001133089 5:169080433-169080455 CAGACTCCTTGCCTTGGCCGTGG - Intronic
1001548227 5:172583878-172583900 GGGACACCTTGACTTGGTCAGGG - Intergenic
1003245219 6:4377184-4377206 CAGTCAGCTTGACTGGGTAGAGG - Intergenic
1005819142 6:29582710-29582732 CAGACACCTTGAGGTGGTTGAGG - Intronic
1014589250 6:123243009-123243031 CTGCCACCTTGACAAGGTCAAGG + Intronic
1016325735 6:142899085-142899107 TACCCTCCTTGACCTGGTCGTGG + Intronic
1017767719 6:157620568-157620590 AGGCCACCTTGACTTGATTGAGG + Intronic
1019444284 7:1063133-1063155 CAGCCACCTTGACTCGCTGGGGG + Intronic
1023121165 7:36910367-36910389 CAGCCACCTTGAAATGGAAGTGG - Intronic
1030195945 7:106853707-106853729 AAGCCACCTTGAGATGGTGGTGG - Intergenic
1032323280 7:130903267-130903289 CAGCCAGCTTTCCTTGGTTGTGG - Intergenic
1035166078 7:156990679-156990701 CAGGCGCTGTGACTTGGTCGCGG - Intergenic
1037823854 8:22148918-22148940 CAGCCAGCTGTACGTGGTCGTGG - Exonic
1039441437 8:37598033-37598055 CAGCAGCCTTGACTTTGTCAGGG + Intergenic
1040596838 8:48846818-48846840 CAGCTGCCTGCACTTGGTCGGGG + Intergenic
1049641549 8:143718238-143718260 CAGCCTCCTTGACGTGATCCGGG + Exonic
1058624368 9:106919235-106919257 CCGCCACCATCACTTGGTCCAGG - Intronic
1191682898 X:63859420-63859442 CCCCCACCTTGGCTTGGTGGGGG - Intergenic
1195883632 X:109618424-109618446 CAGCCACCTGGACTTGCTAGAGG + Intergenic