ID: 1142623382

View in Genome Browser
Species Human (GRCh38)
Location 17:1178839-1178861
Sequence CAGGAGCAAGGTGCGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 561}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142623377_1142623382 -6 Left 1142623377 17:1178822-1178844 CCTTTCTAGCAACGGAGCAGGAG 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1142623382 17:1178839-1178861 CAGGAGCAAGGTGCGGTGGTGGG 0: 1
1: 0
2: 1
3: 38
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142623382 Original CRISPR CAGGAGCAAGGTGCGGTGGT GGG Intronic
900001375 1:16706-16728 CAGGAGCTGGGGGTGGTGGTGGG + Intergenic
900016155 1:151615-151637 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
900021095 1:187228-187250 CAGGAGCTGGGGGTGGTGGTGGG + Intergenic
900046421 1:510207-510229 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
900068622 1:751924-751946 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
900200541 1:1403390-1403412 AAGTAGCCAGGTGCGGTGGCGGG - Intronic
900998635 1:6136338-6136360 CAGGAGCAGGGTGTTGGGGTGGG - Intronic
901931280 1:12597223-12597245 AATTAGCCAGGTGCGGTGGTGGG - Intronic
902079186 1:13809500-13809522 CAGGAGCAGGGTGGAGTGGCAGG + Intronic
902498485 1:16891826-16891848 CAGAAGCAAGGTGATGGGGTGGG - Intronic
902630240 1:17700531-17700553 CAGGAGCAAAGTGTGGGGGCAGG + Intergenic
903534261 1:24056326-24056348 CAGGAGCAGGGTCTGGTGGGAGG - Exonic
904623654 1:31790206-31790228 CAGGAGGAAGAGGTGGTGGTGGG - Intergenic
905058321 1:35118090-35118112 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
905477557 1:38239560-38239582 CAGGAGCCAGATGCAGGGGTCGG - Intergenic
905487886 1:38318713-38318735 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
905642616 1:39601684-39601706 CACCAGCAAGGTGCTGTGGCCGG + Intergenic
906687567 1:47772336-47772358 CAGGACGAAGGTGTGGAGGTGGG + Intronic
908121759 1:60992406-60992428 CAGGAGAAGGGTGTGATGGTGGG + Intronic
908162766 1:61427092-61427114 GGGGAGCAAGGTGCGGTGGGTGG + Intronic
908299487 1:62749528-62749550 AATTAGCAAGGTGTGGTGGTGGG - Intergenic
909585212 1:77281854-77281876 CTGGCGCGAGGTGCGGAGGTGGG - Intergenic
910585928 1:88879429-88879451 AATTAGCCAGGTGCGGTGGTGGG + Intronic
910883862 1:91946127-91946149 AATGAGCCAGGTGTGGTGGTGGG - Intergenic
911161070 1:94683687-94683709 CAGGTGGAATGTGCTGTGGTGGG + Intergenic
912252340 1:108024558-108024580 CTGGAGCATGGTGTGGTGATAGG + Intergenic
912503838 1:110142006-110142028 ATGGAGGAAGGTGAGGTGGTGGG + Intergenic
912818344 1:112848056-112848078 CATTAGCTGGGTGCGGTGGTGGG - Intergenic
912827897 1:112923371-112923393 CGGGAGCAACGTGCAGTGGTTGG - Intronic
913130054 1:115830899-115830921 CAGGAGAAAGGTGGTGTGATTGG + Intergenic
914098553 1:144564739-144564761 CAGAAGCAAGGTGATGGGGTGGG + Intergenic
914191576 1:145415980-145416002 CATTAGCCAGGTGCGGTGGCAGG + Intergenic
914300431 1:146372904-146372926 CAGAAGCAAGGTGATGGGGTGGG - Intergenic
914589504 1:149093984-149094006 CATTAGCCAGGTGCGGTGGCAGG + Intronic
914711894 1:150221939-150221961 AATTAGCAAGGTGTGGTGGTGGG + Intronic
914918134 1:151830805-151830827 CAGGAGCAAGGGGAGGTGGGCGG - Intronic
915141457 1:153771040-153771062 CAGGAGCATGGGGCGGTGGGGGG - Intronic
915287956 1:154864796-154864818 CAGGAGCATGGTGGGGGAGTGGG + Intronic
915586706 1:156847657-156847679 CAGGAGCAGGTTGGGGGGGTGGG + Intronic
915714276 1:157929834-157929856 CAGGAGCAGTGTGTGGTGTTGGG + Intergenic
916440973 1:164824270-164824292 GAATTGCAAGGTGCGGTGGTAGG + Intronic
916584808 1:166141167-166141189 CTGGGGCAAGGTGCTGTGCTAGG + Intronic
920631439 1:207656672-207656694 CAGGAGCAAGGTGGGGAGGACGG + Intronic
920641924 1:207760797-207760819 GAGGAGCAAGGTGGGGAGGACGG + Intronic
920958779 1:210645424-210645446 AATTAGCAAGGTGTGGTGGTAGG - Intronic
921575580 1:216831010-216831032 AAGGGGCAAGGTGGGGAGGTTGG + Intronic
921846032 1:219883325-219883347 CATGAGCAGGGTCTGGTGGTGGG - Intronic
922052093 1:222001492-222001514 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
922103976 1:222497309-222497331 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
922264299 1:223969830-223969852 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
922376413 1:224972450-224972472 AATTAGCCAGGTGCGGTGGTAGG - Intronic
923058942 1:230452559-230452581 CAGCAGCAAGATGAGATGGTGGG + Intergenic
923636930 1:235707472-235707494 AATTAGCCAGGTGCGGTGGTGGG + Intronic
923868806 1:237968727-237968749 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
924346147 1:243074824-243074846 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
924476187 1:244383789-244383811 ATGGAGCAGGGTGCGGTGGAGGG + Intronic
1062934508 10:1375690-1375712 CAGGAGCAAGGGTGGGTGGTAGG - Intronic
1063470110 10:6277618-6277640 CAGGAGGGAGGTGCGGGGGCAGG - Intergenic
1064427115 10:15239443-15239465 CTGGAGCCGGGTGTGGTGGTGGG - Intronic
1064432492 10:15283226-15283248 CAGGGGCAAGCTGTGGAGGTGGG - Intronic
1064507346 10:16047456-16047478 AAGTAGCAGGGTGTGGTGGTGGG + Intergenic
1064999184 10:21321508-21321530 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1065915399 10:30350695-30350717 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1066489127 10:35877081-35877103 CAGTAGCCAGGCGTGGTGGTGGG - Intergenic
1066730199 10:38430002-38430024 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1067084314 10:43229891-43229913 TAGGAGCATGGCGCGGAGGTGGG + Intronic
1067552432 10:47245172-47245194 CAGGGGGAGGGTGCGGTGGGGGG + Intergenic
1067665110 10:48270957-48270979 CAGGGGCAAGGTATGGTTGTAGG - Intronic
1067727649 10:48782905-48782927 CAGGAGCAAGGTGGGTTGGAGGG + Intronic
1069117706 10:64528483-64528505 CAGGAGGAAGGCGGGGTGGGAGG - Intergenic
1069335010 10:67338282-67338304 CATGAGCAAGGTGTGGGGGGAGG + Intronic
1069429905 10:68325093-68325115 AAGTAGCCAGGTGCGGTGGCAGG + Intronic
1069938071 10:71933022-71933044 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1070240930 10:74679810-74679832 AATTAGCAAGGTGTGGTGGTGGG + Intronic
1070567098 10:77612149-77612171 CAGGAGCAAGGTCTGGTGCTGGG - Intronic
1070812015 10:79303008-79303030 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1072144757 10:92624916-92624938 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1072237103 10:93462908-93462930 CAGGAGCCAGGTTGGGGGGTAGG - Intronic
1072358910 10:94639941-94639963 CCGGGGGAAGGTGCGGTGGTGGG - Intergenic
1072719681 10:97772616-97772638 AAGGTGCAAGGTGCGGTGCAAGG + Intergenic
1073036502 10:100567496-100567518 CATGAGAACGGGGCGGTGGTGGG + Intergenic
1073356475 10:102858951-102858973 CAGGAGCAGGGTGCAGTATTAGG + Intronic
1073444213 10:103571218-103571240 CAGGGGCAGGGTGTGGTGCTGGG - Intronic
1074801907 10:117008231-117008253 CAGGACCAAGGTGTGGGGGTTGG + Intronic
1075886290 10:125902100-125902122 CAAGAGCAATGTGAGGTGGGGGG + Intronic
1076386055 10:130056738-130056760 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1076466004 10:130681981-130682003 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1076742523 10:132493842-132493864 CAGGCGCCAGGTGCTGTGCTGGG - Intergenic
1076806670 10:132862362-132862384 GAGGAGGAGGGTGCGGAGGTGGG + Intronic
1076972747 11:146685-146707 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1077116897 11:889285-889307 CAGGACCAAGGTGGGTGGGTGGG - Intronic
1077380573 11:2235129-2235151 CAGAAGCAAAGGGAGGTGGTGGG - Intergenic
1077883980 11:6372261-6372283 CATGTGCAAGGTGCTGTGGTGGG - Intergenic
1078094215 11:8286696-8286718 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1078202343 11:9194866-9194888 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1078939013 11:15979614-15979636 CAGGAGCAAAGTGAGTAGGTAGG - Intronic
1080305251 11:30828195-30828217 CAGGAGCAAAGTCCTGAGGTGGG - Intergenic
1080368666 11:31608967-31608989 CAGGGCCAAGGAGCTGTGGTAGG + Intronic
1081308373 11:41541071-41541093 AATTAGCAAGGTGTGGTGGTAGG + Intergenic
1082861807 11:57864052-57864074 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1082899259 11:58228114-58228136 CAGGACCACGGTGAGGTGGAAGG + Exonic
1082904543 11:58292015-58292037 CAGGACCACGGTGAGGTGGGAGG + Intergenic
1083105740 11:60356826-60356848 CAGGAGAAGGGTGGGGTGGGTGG - Intronic
1083201142 11:61121723-61121745 CAGGAGCTCGCTGCGGTGGGAGG + Exonic
1083297423 11:61722611-61722633 CAGAAGCTAGGAGAGGTGGTGGG + Intronic
1083877558 11:65532274-65532296 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1083895780 11:65619043-65619065 CAGGAGGAAGGTGCTGTGGGGGG + Exonic
1084218283 11:67663326-67663348 GAGCAGGCAGGTGCGGTGGTGGG + Exonic
1084270719 11:68027800-68027822 CAGGAGGCAGGCGCGATGGTGGG - Exonic
1084318665 11:68360846-68360868 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1084450648 11:69234736-69234758 CAGGAGGAAGGGGGGGGGGTGGG + Intergenic
1085049649 11:73373649-73373671 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1087887043 11:103493617-103493639 CAGGAGCAATCTGGGGGGGTAGG - Intergenic
1087924771 11:103906960-103906982 AATGAGCCAGGTGTGGTGGTGGG - Intergenic
1087940442 11:104090478-104090500 AATCAGCCAGGTGCGGTGGTGGG + Intronic
1088753814 11:112868527-112868549 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1089634604 11:119804191-119804213 CAGGTGCAAGGAGAGGTGGAAGG + Intergenic
1090132990 11:124164671-124164693 AAGTAGCCAGGCGCGGTGGTGGG - Intergenic
1090318449 11:125818471-125818493 CTGGAGGAAGGGGAGGTGGTGGG + Intergenic
1090647305 11:128776500-128776522 AATGAGCCAGGTGTGGTGGTGGG + Intronic
1090857271 11:130621449-130621471 TAGGAGCAAGGCACTGTGGTGGG + Intergenic
1091374464 12:16821-16843 CAGGAGCTGGGGGTGGTGGTGGG + Intergenic
1094738229 12:33259488-33259510 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1094751076 12:33409363-33409385 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1095268536 12:40188502-40188524 AAGTAGCCAGGTGTGGTGGTAGG - Intergenic
1096039283 12:48500354-48500376 CAGGAGGGAGGTGGGGGGGTCGG - Intergenic
1096211631 12:49770652-49770674 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
1096389618 12:51218155-51218177 CAGGAGCGAGGGGTGGGGGTGGG + Intergenic
1096640228 12:52988409-52988431 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
1097012793 12:55965400-55965422 CAGGAGCAAGGGGCGGGGGTGGG - Intronic
1097081848 12:56437595-56437617 CAGAAGCAAGGTGAAGGGGTAGG + Intronic
1097657033 12:62378056-62378078 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1097906102 12:64921255-64921277 CAATAGCCAGGTGAGGTGGTGGG - Intergenic
1099812338 12:87599671-87599693 CAGGAACAAGCTGCAGTGATAGG + Intergenic
1100633799 12:96414853-96414875 CAGGAACAAGATGCGGTAGGTGG + Intergenic
1102553085 12:113706370-113706392 AATGAGCCAGGTGCAGTGGTGGG + Intergenic
1102630424 12:114273975-114273997 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
1102769996 12:115467460-115467482 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1103420684 12:120779847-120779869 AATTAGCAAGGTGTGGTGGTGGG + Intronic
1103623399 12:122201973-122201995 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1103714176 12:122934097-122934119 AATTAGCAAGGTGTGGTGGTGGG + Intronic
1103916654 12:124379247-124379269 CAGGAGCAGGGTGCGGTGCGGGG - Intronic
1104288694 12:127448461-127448483 CATTAGCTAGGTGTGGTGGTGGG + Intergenic
1104359311 12:128117084-128117106 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1104461568 12:128960606-128960628 AATGAGCCAGGTGTGGTGGTGGG + Intronic
1105433699 13:20359754-20359776 CCTGACCAAGGTGGGGTGGTGGG - Intergenic
1105625689 13:22110528-22110550 TAGGAGGAACATGCGGTGGTGGG + Intergenic
1106035051 13:26036554-26036576 TAGGAGAAAGCTGTGGTGGTAGG + Intergenic
1106680523 13:32002331-32002353 AATGAGCCAGGTGTGGTGGTGGG - Intergenic
1106714085 13:32369720-32369742 AAGTAGCCAGGTGAGGTGGTGGG - Intronic
1107440741 13:40425387-40425409 CTGGAGCAGGGTGAGGTGGAGGG - Intergenic
1108487227 13:50939206-50939228 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1109415573 13:62034791-62034813 CAGGAGCAAGGTTCAAGGGTAGG - Intergenic
1110565628 13:76954976-76954998 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1110911823 13:80975234-80975256 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
1111237345 13:85426882-85426904 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1111549290 13:89785334-89785356 CAGTAGCCAGGCGTGGTGGTGGG - Intergenic
1112463472 13:99622979-99623001 AATGAGCCAGGTGTGGTGGTGGG - Intronic
1114492294 14:23110849-23110871 GAGGAAAAGGGTGCGGTGGTAGG + Intergenic
1115241362 14:31253544-31253566 CATTAGCCAGGTGCGGTGGCAGG + Intergenic
1115833609 14:37372604-37372626 AATGAGCAAGGCGTGGTGGTGGG + Intronic
1115989977 14:39141415-39141437 CAGGTGCATGGTGCAATGGTAGG + Intergenic
1116657956 14:47674910-47674932 GAGGAGCAGGGGGCGGTGATGGG + Exonic
1116969900 14:51053009-51053031 CAACAGCCAGGTGCGGTGGTGGG + Intronic
1119080064 14:71684569-71684591 CAGTCGCAATGTGCGGTGGCGGG + Intronic
1119320005 14:73724973-73724995 CAGGAGGAAGATGCGGAGGAGGG - Intronic
1119417590 14:74484263-74484285 AAGGAGATAGGTGCGGTGTTAGG - Intronic
1120954590 14:90070798-90070820 GAGGAGCAATGTGTGGTCGTGGG + Intronic
1121077125 14:91078175-91078197 AAGGAGCCAGGCGTGGTGGTGGG - Intronic
1121681062 14:95793019-95793041 CAGGAGCAAGGGGCGCGGGAGGG - Intergenic
1122304847 14:100757511-100757533 AATTAGCAGGGTGCGGTGGTGGG + Intergenic
1122319449 14:100845080-100845102 CAGAAGCAAGGTGCCCAGGTCGG - Intergenic
1122397788 14:101446663-101446685 CATGAGCAAGGTGGAGGGGTAGG - Intergenic
1122538107 14:102480371-102480393 CATTAGCCAGGTGTGGTGGTGGG - Intronic
1122596917 14:102900028-102900050 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1124033771 15:26034650-26034672 CACTAGCCAGGTGTGGTGGTGGG - Intergenic
1124648382 15:31456737-31456759 GAGGAGCAAGGTGCAGTGGATGG - Intergenic
1125012021 15:34888147-34888169 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1125463145 15:39925147-39925169 CAGGAGGAGGGTTCGGTGGAGGG + Intergenic
1125980825 15:43999592-43999614 CAGGAGTCAGGTGTGGGGGTAGG - Intronic
1126901293 15:53317216-53317238 AAGGAGCCAGGTGTGGTGGCGGG + Intergenic
1127427485 15:58870320-58870342 AATTAGCCAGGTGCGGTGGTAGG + Intronic
1128039437 15:64557843-64557865 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1128060872 15:64735141-64735163 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1128303728 15:66583924-66583946 AATGAGCCAGGTGTGGTGGTGGG - Intronic
1128808137 15:70549224-70549246 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1129867401 15:78919733-78919755 CACTAGCCAGGTGTGGTGGTGGG + Intergenic
1129889012 15:79058669-79058691 CTGGAGCAAGGCGGGGCGGTGGG + Intronic
1130143104 15:81248867-81248889 AATTAGCAAGGTGTGGTGGTGGG - Intronic
1130332913 15:82935253-82935275 CAGGAGCCAGGTGGGTTGGAAGG - Intronic
1130442515 15:83969293-83969315 AAGTAGCAGGGTGCAGTGGTGGG + Intronic
1130585048 15:85174177-85174199 CAGGACCAAGGGGTGGTGGGAGG + Intergenic
1131128790 15:89880523-89880545 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1131929633 15:97426871-97426893 AAAGAGCTGGGTGCGGTGGTGGG - Intergenic
1132452132 15:101974232-101974254 CAGGAGCTGGGGGTGGTGGTGGG - Intergenic
1132454761 16:16389-16411 CAGGAGCTGGGGGTGGTGGTGGG + Exonic
1132986624 16:2770749-2770771 CGGGAGCCAGTTGTGGTGGTGGG + Intronic
1133027749 16:2996079-2996101 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1133289497 16:4709860-4709882 CATTAGCCAGGTGTGGTGGTAGG + Intronic
1133555686 16:6904450-6904472 AATGAGCTAGGTGTGGTGGTGGG + Intronic
1133672017 16:8031972-8031994 AAGGAGCCAGGCGTGGTGGTGGG + Intergenic
1133941043 16:10309298-10309320 AATGAGCTAGGTGTGGTGGTGGG - Intergenic
1134784132 16:16925489-16925511 CAGAAGCAAAGAGGGGTGGTGGG + Intergenic
1136128060 16:28199713-28199735 CATTAGCCAGGTGTGGTGGTGGG - Intronic
1137382925 16:48015195-48015217 CAGGAGCAAGGGGCCGGGGGAGG + Intergenic
1137649306 16:50105698-50105720 CAAAAACAAGGTGTGGTGGTGGG - Exonic
1138057328 16:53848782-53848804 CAGGAGCTGGGTGTGGAGGTGGG + Intronic
1138453281 16:57106302-57106324 CAGGGGCAGGGGGCGGTGGCTGG - Intronic
1138501505 16:57447682-57447704 CACGAGCAAGGTGAGGTGAAGGG + Intronic
1139411773 16:66767874-66767896 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1139544017 16:67640585-67640607 AATTAGCAAGGTGTGGTGGTGGG - Intergenic
1139564540 16:67765685-67765707 AAGTAGCCAGGTGTGGTGGTGGG + Intronic
1139592201 16:67939609-67939631 GAGGAGCACGGGGCGGTGGGGGG - Intergenic
1139822201 16:69729458-69729480 CATGAGCTGGGTGTGGTGGTGGG + Intergenic
1140482186 16:75267629-75267651 CAGGAGCAAGGGAGGGAGGTGGG - Intronic
1141289742 16:82706653-82706675 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1141323709 16:83036296-83036318 AAGTAGCCAGGTGTGGTGGTGGG - Intronic
1141517267 16:84553941-84553963 CTGGAGGCAGGTGCGGAGGTAGG - Intronic
1141694545 16:85613441-85613463 CAGGAGGACAGTGCGGTGGGGGG - Intronic
1142447502 16:90150842-90150864 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1142459991 17:84490-84512 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1142623382 17:1178839-1178861 CAGGAGCAAGGTGCGGTGGTGGG + Intronic
1143051487 17:4129686-4129708 AATGAGCCAGGTGTGGTGGTAGG + Intronic
1143189588 17:5031840-5031862 CTGGAGGAAGGTCCGGAGGTGGG + Intergenic
1143243194 17:5461468-5461490 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1143643743 17:8215925-8215947 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1143825037 17:9598610-9598632 AAGTAGCCAGGTGTGGTGGTAGG + Intronic
1144094529 17:11888129-11888151 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1144467680 17:15509312-15509334 CTGGACCAAGGGGAGGTGGTAGG + Intronic
1144711939 17:17406952-17406974 CATGAGCCAGATGCGGTGGTTGG - Intergenic
1145125195 17:20294128-20294150 AATGAGCCAGGTGTGGTGGTGGG - Intronic
1145325179 17:21816727-21816749 CACTAGCCAGGTGTGGTGGTGGG - Intergenic
1146454682 17:32999783-32999805 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1146528959 17:33591597-33591619 CAGGAGACAGGTGCAATGGTGGG - Intronic
1147116233 17:38301966-38301988 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1147456257 17:40540123-40540145 TTGAAGCAAGGGGCGGTGGTGGG - Intergenic
1147590107 17:41677293-41677315 AATGAGCCAGGTGTGGTGGTGGG - Intergenic
1147790462 17:43011368-43011390 AATGAGCCAGGTGTGGTGGTGGG + Intronic
1148362443 17:47023530-47023552 AAGTAGCCAGGTGTGGTGGTGGG + Intronic
1148461118 17:47839511-47839533 CAGCAGGAAGGTGCTATGGTAGG + Exonic
1149874542 17:60218233-60218255 AATGAGCCAGGTGTGGTGGTGGG + Intronic
1150088329 17:62295484-62295506 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
1150178849 17:63092672-63092694 CAGGAGCAAGGGGTGGAGGGAGG + Intronic
1150200706 17:63354110-63354132 CAGGAGCAAAGTCCGTGGGTAGG + Intronic
1150484575 17:65534779-65534801 AAGGAGCTGGGTGTGGTGGTGGG + Intronic
1150767389 17:68013008-68013030 AAGTAGCCAGGTGTGGTGGTGGG - Intergenic
1152284097 17:79402568-79402590 CAGGAGCCACATGGGGTGGTGGG + Intronic
1152393068 17:80014206-80014228 AATGAGCCAGGTGCGGTGGCGGG + Intronic
1152940202 17:83166659-83166681 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1154267347 18:12890771-12890793 CAGGAGCAAGGTGCTGGGGGAGG - Intronic
1154492329 18:14931902-14931924 CAGGAGGGAGGTGGGGTGGGGGG - Intergenic
1156684281 18:39625943-39625965 CAGGAGCAGAGTGTGGTGATAGG - Intergenic
1157199946 18:45651600-45651622 CAGGAGCAGGGTGTGGAGGCCGG + Intronic
1157235541 18:45961707-45961729 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1158451202 18:57567112-57567134 TAGGAGCAGGGTGAGGTGGGGGG - Intronic
1158760130 18:60375041-60375063 AATTAGCAAGGTGCGGTGGCGGG - Intergenic
1159564317 18:70031870-70031892 CAGGAACAAGTTGTGGTGCTTGG - Intronic
1159702780 18:71650291-71650313 CAGGAGCAAGGTGTGGGGTGGGG - Intergenic
1160060089 18:75521902-75521924 CAGGAGGAAGGTGCTGCGGCAGG - Intergenic
1160497239 18:79382830-79382852 CAGGAGCAGGGCGGGGTGGCCGG - Intergenic
1160561658 18:79762368-79762390 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
1160649706 19:216989-217011 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1160786122 19:900859-900881 CAGGAGCAAGGCGCGGAGGAGGG - Exonic
1161540819 19:4850391-4850413 CATTAGCCAGGTGCGGTGGCAGG - Intronic
1161960616 19:7520914-7520936 CAGGAGCAAGGGGCACTGCTGGG + Exonic
1162179853 19:8860980-8861002 CAGGTACAAGGTGGGGTGGCTGG - Exonic
1162223063 19:9195744-9195766 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1162716548 19:12638062-12638084 CAGGAGCAAGGTGCCTTCCTGGG + Intronic
1163007647 19:14406578-14406600 CAGGAGGAAGGCGGGGTGCTGGG + Intronic
1163270882 19:16252670-16252692 CGGGAGCAGGGAGCGATGGTGGG + Intergenic
1163284571 19:16338437-16338459 CAGGGGCAAGGGGCAGAGGTAGG - Intergenic
1163370454 19:16898291-16898313 AATTAGCAGGGTGCGGTGGTGGG - Intronic
1163379766 19:16957508-16957530 GAGGAGCAAGGAGTGGGGGTAGG + Intronic
1163441475 19:17324387-17324409 CAGGAGAAGGGTGGGCTGGTTGG + Intronic
1163470329 19:17492972-17492994 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1163640431 19:18458901-18458923 TAGGAGCCAGGTGTGGTGGCTGG - Intronic
1163752037 19:19083882-19083904 CAGGGGCATGCTGGGGTGGTGGG - Intronic
1163752057 19:19083942-19083964 CAGGGGCACGCTGGGGTGGTGGG - Intronic
1163752074 19:19084002-19084024 CAGGGGCATGCTGGGGTGGTGGG - Intronic
1164115121 19:22212554-22212576 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1164198932 19:23000717-23000739 AAGTAGCCAGGTGTGGTGGTGGG + Intronic
1164451618 19:28370905-28370927 CAGGAGCGGGAGGCGGTGGTGGG + Intergenic
1164563191 19:29308209-29308231 AATCAGCCAGGTGCGGTGGTGGG - Intergenic
1165005334 19:32800955-32800977 GAGGAGCCAGGTGCGGGGGCAGG + Intronic
1165397969 19:35577535-35577557 CAGGAGCACGGGGCTGTGGTGGG - Intergenic
1165405949 19:35631234-35631256 GAGTAGCAAGGTGAGGGGGTTGG + Intronic
1165955759 19:39501146-39501168 AAGTAGCCAGGTGTGGTGGTGGG - Intronic
1166013788 19:39964712-39964734 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
1166889316 19:45980765-45980787 TATTAGCAAGGTGTGGTGGTGGG + Intergenic
1167605215 19:50478314-50478336 CAGCAGCCATGTGAGGTGGTAGG + Intronic
1167895967 19:52581366-52581388 AAGTAGCCAGGTGTGGTGGTGGG - Intronic
1168034900 19:53711587-53711609 AAGTAGCCAGGTGTGGTGGTGGG - Intergenic
1168165875 19:54547355-54547377 AAGTAGCCAGGTGTGGTGGTGGG - Intergenic
925128895 2:1480780-1480802 CAGGAGGAAGGTGGTGTGGACGG - Intronic
925447752 2:3942646-3942668 CAGGAGCCAGGTGGGCAGGTGGG + Intergenic
925472651 2:4179405-4179427 TATTAGCCAGGTGCGGTGGTGGG + Intergenic
925707168 2:6697384-6697406 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
925943468 2:8840302-8840324 CAGGAGCAAGGGTGGGTGGGAGG - Intergenic
926017851 2:9470072-9470094 AATGAGCCAGGTGTGGTGGTGGG + Intronic
926136274 2:10338831-10338853 CAGAAGCATGGTGCAGTGGTGGG + Intronic
926365679 2:12130918-12130940 CAGGAGCAACATCCGTTGGTAGG - Intergenic
927241644 2:20924657-20924679 CAGGAGCAGGGTAGGGTGGAGGG + Intergenic
928349797 2:30539356-30539378 CAGGAGGAGGGTGAGGTGGAAGG - Intronic
928546524 2:32334171-32334193 AATTAGCTAGGTGCGGTGGTGGG + Intergenic
928643954 2:33332247-33332269 CATAAGCCAGGTGTGGTGGTGGG + Intronic
928801989 2:35106325-35106347 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
929059123 2:37905252-37905274 CAGGGCAAAGGTGCTGTGGTGGG - Intergenic
929083254 2:38142422-38142444 CAGGGGCAGGGTGTGGTGGGGGG - Intergenic
929516029 2:42605714-42605736 CAGGAGGGAGGTGGGGGGGTCGG - Intronic
929982259 2:46692514-46692536 CAGAAGCAAGGGGCAGTGGTAGG - Intergenic
930711188 2:54552603-54552625 AATGAGCCAGGTGTGGTGGTGGG - Intronic
931855606 2:66299136-66299158 CAGGGGCAAGGCCAGGTGGTGGG + Intergenic
932891779 2:75603465-75603487 CATGAGCCAGCTGCAGTGGTGGG - Intergenic
934069900 2:88374282-88374304 CAGGAGCAAGTGGTGGTGGGGGG + Intergenic
934120178 2:88830885-88830907 AAGTAGCCAGGTGCGGTGGCAGG + Intergenic
934506544 2:94898766-94898788 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
935313230 2:101806054-101806076 CAGGAGCAGGGTATGGTGGGTGG - Intronic
935675745 2:105593938-105593960 CAGGAGCAAGGGGCTGTCCTGGG - Intergenic
935878058 2:107534054-107534076 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
936102443 2:109594677-109594699 GAGGATCACGGTGAGGTGGTGGG - Intronic
936568349 2:113596708-113596730 CAGGAGCTGGGGGTGGTGGTGGG - Intergenic
936851281 2:116900906-116900928 CATTAGCCAGGTGTGGTGGTAGG - Intergenic
937911458 2:127077640-127077662 CAGAGGCAAGGAGCGGTGGTGGG + Intronic
937957350 2:127428786-127428808 CAGGAACCAGGTGCCGTGGAAGG - Exonic
939107921 2:137971326-137971348 AATTAGCCAGGTGCGGTGGTTGG - Intronic
939929102 2:148209776-148209798 GAGGAGCAAGGGGCGGGGGGAGG + Intronic
943116689 2:183681262-183681284 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
944232308 2:197408772-197408794 AAGTAGCCAGGTGTGGTGGTGGG + Intronic
945199988 2:207271933-207271955 GAGGAGCAAGGTTCTGAGGTGGG + Intergenic
945522470 2:210845371-210845393 CATGAGCAGGGTGCTGTGGCAGG - Intergenic
946042503 2:216794467-216794489 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
946297515 2:218797246-218797268 CATTAGCCAGGTGTGGTGGTGGG - Intronic
946333722 2:219024210-219024232 CAGGAGCAGGCTGCGGTAGGTGG + Exonic
946791891 2:223309346-223309368 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
946845140 2:223852162-223852184 GAGGAGCCAGGTGTGGTGTTGGG - Intergenic
947550442 2:231041668-231041690 CAGGAGCATGGTGGGGTGCATGG + Intronic
947763064 2:232617798-232617820 CATTAGCCAGGTGTGGTGGTGGG + Intronic
947789498 2:232856077-232856099 CATTAGCTAGGTGTGGTGGTGGG - Intronic
948340694 2:237248951-237248973 TAGGAGCAAAGAGGGGTGGTGGG + Intergenic
948615886 2:239198522-239198544 CAGGAGCAAGCTGAGGATGTGGG - Intronic
948736329 2:240008737-240008759 CAGGAGCCAGGTGCTGTGTGGGG + Intronic
1171289118 20:23970196-23970218 CAAGAGCAAGGTGCTGTGCCAGG + Intergenic
1172259298 20:33548390-33548412 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1172335492 20:34112201-34112223 CAAGAGCCTAGTGCGGTGGTGGG - Exonic
1172337962 20:34132731-34132753 CAGGAGGGAGGTGGGGGGGTCGG + Intergenic
1172791170 20:37506484-37506506 CAGGAGCAAAGGGCGAGGGTGGG - Intronic
1172843893 20:37918222-37918244 CAGGAGCAAGGCTTGGAGGTGGG + Intronic
1174014655 20:47478022-47478044 AATTAGCCAGGTGCGGTGGTCGG + Intergenic
1174083058 20:47984381-47984403 CTGGAGCAAGGTGCTTTGGGTGG + Intergenic
1174096900 20:48096882-48096904 AATGAGCCAGGTGCAGTGGTGGG + Intergenic
1174339996 20:49889531-49889553 CAGGGTCAAGGCGAGGTGGTAGG - Exonic
1175328663 20:58147777-58147799 CAGGAGCAAGGGCCGGGGGAGGG + Intergenic
1175411460 20:58772460-58772482 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
1175806265 20:61830863-61830885 CAGGAGAGAGGAGCGGAGGTGGG - Intronic
1176387470 21:6145912-6145934 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1177297083 21:19189100-19189122 CACGAGGAAGGTGCAGAGGTGGG + Intergenic
1178820160 21:35967530-35967552 CAGGCGCAAGGTGCAGTGACTGG + Intronic
1178945479 21:36943668-36943690 CAGGAGCCAGGTGTGTTGATGGG + Intronic
1179153778 21:38832025-38832047 CCGGAGGAAGGTGGGTTGGTTGG + Intergenic
1179577263 21:42315695-42315717 CAGGAGCCATGTGGGGTGGCAGG + Intergenic
1179736002 21:43392336-43392358 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1179881134 21:44293779-44293801 CAGGAGCCAGGTTCTGTGGGAGG - Exonic
1180662749 22:17482827-17482849 AAGTAGCAAGGTGTGGTGGTGGG - Intronic
1180853507 22:19033014-19033036 CGGGAACAAGGTGGGGTGGCCGG - Intergenic
1180944745 22:19686033-19686055 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1181867408 22:25869624-25869646 CAGGAGCTATGTGAGGTGGTGGG + Intronic
1183809038 22:40238475-40238497 CAGAAGCAGGATTCGGTGGTTGG - Intronic
1183934765 22:41255803-41255825 AAGGGGCCAGGTGTGGTGGTGGG + Intronic
1184028052 22:41872740-41872762 AATGAGCCAGGTGTGGTGGTGGG + Intronic
1184094985 22:42311579-42311601 CAGGAGCAAGGTGCAGTTGAAGG + Intronic
1184113235 22:42407515-42407537 CATTAGCCAGGTGTGGTGGTAGG - Intronic
1184803846 22:46779405-46779427 CATTAGCCAGGTGTGGTGGTGGG - Intronic
949473435 3:4419873-4419895 TATGAGCAAGGTGCAGTGTTTGG + Intronic
949966920 3:9364493-9364515 CATTAGCCAGGTGTGGTGGTGGG - Intronic
950428578 3:12938037-12938059 CAGGAGCAAGGTGCAGGGAGTGG - Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
951561878 3:23975608-23975630 AATGAGCCAGGTGTGGTGGTGGG + Intronic
952490863 3:33871326-33871348 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
953455609 3:43039349-43039371 AATGAGCCAGGTGTGGTGGTGGG - Intronic
954207278 3:49069249-49069271 AAGTAGCCAGGTGTGGTGGTGGG - Intronic
955211267 3:56943764-56943786 CATTAGCCAGGTGTGGTGGTGGG + Intronic
955260259 3:57382014-57382036 AATTAGCCAGGTGCGGTGGTGGG - Intronic
957121304 3:76097312-76097334 CAGGAGCAAGTTCAGGTGCTAGG - Intronic
958544682 3:95529341-95529363 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
958957905 3:100481035-100481057 CAGGAGCTTGGTGAGGTGGTGGG - Intergenic
960328968 3:116333388-116333410 AATTAGCAAGGTGTGGTGGTGGG + Intronic
961521030 3:127467461-127467483 CAGGAGGAAGGGGAGGTGGATGG - Intergenic
962008811 3:131374022-131374044 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
962033568 3:131627042-131627064 AATTAGCCAGGTGCGGTGGTGGG + Intronic
962816710 3:139006634-139006656 CAAGAGCGAGGTGCGGAGGTGGG + Intronic
963039666 3:141059484-141059506 CAAGAGCAAGAGGCGGGGGTGGG + Intronic
963448871 3:145451872-145451894 AATTAGCAAGGTGTGGTGGTGGG - Intergenic
964071982 3:152646304-152646326 AAGGAGCAAGGTGTGATGCTGGG + Intergenic
964609654 3:158598318-158598340 CAGGAGGGAGGTGTGGGGGTTGG + Intronic
965858834 3:173122673-173122695 TATGAGCAAGGTGCTGTGCTAGG + Intronic
966832895 3:184025893-184025915 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
966992384 3:185246532-185246554 CAAGAGCCTAGTGCGGTGGTGGG - Intronic
967035442 3:185645751-185645773 CTGGAGTAACGTGCGGGGGTGGG - Intronic
967094825 3:186168699-186168721 CATTAGCCAGGTGTGGTGGTGGG + Intronic
967667438 3:192189939-192189961 CAGGAGCAAGGGGGGATGGTGGG + Intronic
968368145 3:198203140-198203162 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
968381067 4:96242-96264 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
968601840 4:1513257-1513279 CCGGTGCAAGGTGCGGCCGTGGG + Intergenic
968785301 4:2617412-2617434 AATTAGCCAGGTGCGGTGGTGGG - Intronic
968844465 4:3032327-3032349 AATTAGCCAGGTGCGGTGGTGGG + Intronic
969194909 4:5553227-5553249 CAGGAGCAAGTGGAGTTGGTGGG + Intronic
969535545 4:7754474-7754496 CAAGAGGAAGGTGAGGAGGTTGG + Intergenic
970043206 4:11820177-11820199 AATGAGCCAGGTGTGGTGGTGGG - Intergenic
970747773 4:19320187-19320209 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
971195013 4:24464834-24464856 CAGGAGAAACATGCGGTGGAGGG - Intergenic
972395914 4:38659848-38659870 TAGAAGCCAGGTGTGGTGGTGGG - Intergenic
973708210 4:53600877-53600899 CATTAGCCAGGTGTGGTGGTGGG - Intronic
974607264 4:64169641-64169663 AATTAGCAGGGTGCGGTGGTGGG - Intergenic
975561139 4:75709269-75709291 AATTAGCCAGGTGCGGTGGTTGG + Intronic
977891112 4:102312699-102312721 CAGTACCTAGGTGCTGTGGTAGG - Intronic
979256573 4:118612860-118612882 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
979331777 4:119427680-119427702 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
982284047 4:153715913-153715935 AATTAGCCAGGTGCGGTGGTGGG + Intronic
983191657 4:164760589-164760611 CATGAGCCAGGTGTGGTGGTGGG + Intergenic
984933100 4:184865692-184865714 CATTAGCCAGGTGCGGTGATGGG + Intergenic
985798517 5:1984503-1984525 AAGGAGGAATGTGCGGTGGCCGG + Intergenic
986178996 5:5376133-5376155 CAAGAGCAAGGTGAGGTGGGTGG + Intergenic
986577850 5:9230845-9230867 CAGGAGCAACGAGTGGAGGTGGG + Intronic
986612293 5:9581376-9581398 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
986792934 5:11181115-11181137 CAGGAGCAGGGTGCAGTGGCGGG + Intronic
987654479 5:20788631-20788653 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
988455137 5:31380920-31380942 CATTAGCTAGGTGTGGTGGTGGG + Intergenic
988784110 5:34550082-34550104 AATGAGCAAGGTGTGGTGGCAGG + Intergenic
990529980 5:56663767-56663789 CAGGAGCCAGGAGCAGGGGTTGG - Intergenic
991688945 5:69207658-69207680 CATTAGCCAGGTGTGGTGGTGGG + Intronic
992140257 5:73789393-73789415 AAGGAGGATGGTGAGGTGGTTGG + Intronic
992885645 5:81157203-81157225 CATTAGCCAGGTGCGGTGGTGGG + Intronic
993941931 5:94068884-94068906 AAGGAGCCAGGTGTGGTGGTGGG + Intronic
994026270 5:95087991-95088013 CAGGAGCAAAATGCGCTGGGTGG + Intronic
995283705 5:110363141-110363163 CAGGAGCAAGGGTGGGTGGTGGG + Intronic
996069958 5:119122264-119122286 CGGGAGGGAGGTGGGGTGGTCGG - Intronic
997470973 5:134116488-134116510 CAGGAGAAACGTGCTGTGTTCGG + Intronic
1000998995 5:167987474-167987496 AAGTAGCCAGGTGTGGTGGTGGG - Intronic
1001330679 5:170760253-170760275 CAGGAGCCAGCTGAGGTGGAGGG + Intergenic
1001518682 5:172375209-172375231 AATGAGCCAGGTGTGGTGGTGGG + Intronic
1002292406 5:178208995-178209017 CAGGACCAAGGTGTGGTGCCTGG + Intronic
1002651116 5:180695405-180695427 CAGGAACAAGGTGAGGATGTTGG + Intergenic
1002727364 5:181308368-181308390 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1003310215 6:4963959-4963981 AATGAGCCAGGTGTGGTGGTGGG - Intergenic
1003598925 6:7500543-7500565 CAGGAGCATGGTGCCGTGAGCGG + Intergenic
1003761219 6:9180851-9180873 CAGGAGCAAGGTGGGAGGGGAGG + Intergenic
1004018516 6:11754698-11754720 CAGGAACAAGGTGTGGGGGCTGG + Intronic
1004284423 6:14307664-14307686 TAGGACCAAGGTGCGGGGGTGGG - Intergenic
1004627447 6:17390200-17390222 CAGGAGCAAGGGGAGGAGGGAGG - Intergenic
1004727679 6:18326835-18326857 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1005191256 6:23227360-23227382 CATGAGCCAGGTGTGGTGGCGGG - Intergenic
1005468964 6:26143143-26143165 CAGGAGAAAGGCTCTGTGGTAGG - Intergenic
1005525622 6:26644962-26644984 CTGTAGCAAGGTGCGGGGGGAGG - Intronic
1005629309 6:27692905-27692927 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
1006031298 6:31178481-31178503 CAGGAGGCAGGTGCTGGGGTGGG + Intronic
1006353217 6:33536687-33536709 CATTAGCTAGGTGTGGTGGTGGG + Intergenic
1006507209 6:34497095-34497117 AATCAGCCAGGTGCGGTGGTGGG - Intronic
1006633308 6:35444849-35444871 AATGAGCCAGGTGTGGTGGTGGG - Intergenic
1006717328 6:36128937-36128959 GAGGAGCAAGGTGGGCAGGTGGG - Intronic
1006945343 6:37780664-37780686 CAGGTGCAGAGTGGGGTGGTGGG + Intergenic
1007173268 6:39879297-39879319 CGGGAGGAAGGGGTGGTGGTGGG - Exonic
1007493653 6:42244025-42244047 AATGAGCCAGGTGCGGTGGCGGG - Intronic
1007610882 6:43147994-43148016 CATCAGCTAGGTGCGGTGGGAGG + Intronic
1007622257 6:43222424-43222446 CAGAAGCAGGTTGGGGTGGTGGG + Intronic
1009418130 6:63437779-63437801 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
1011411299 6:87069343-87069365 CAGGAGCAAGGTTCGTTGGACGG - Intergenic
1011485136 6:87833321-87833343 AAGTAGCCAGGTGTGGTGGTGGG - Intergenic
1011524819 6:88253225-88253247 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1012997125 6:105985116-105985138 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1013122245 6:107151174-107151196 CAGGTGGGAGGTGCGGTGGGAGG + Intergenic
1013303740 6:108829103-108829125 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1014413360 6:121153588-121153610 CAGGGGGAAGGGGCGGTTGTGGG - Intronic
1014558054 6:122856826-122856848 CAGGAGCAAGGTGGTGGGGGTGG + Intergenic
1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG + Intergenic
1014985988 6:128010308-128010330 CAAGTGCAAGGTGCTGTGTTGGG - Intronic
1015049070 6:128817031-128817053 AATGAGCCAGGTGTGGTGGTGGG - Intergenic
1015348899 6:132193740-132193762 CATTAGCAGGGTGTGGTGGTGGG + Intergenic
1017422163 6:154283447-154283469 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1018207115 6:161446095-161446117 CTGGAGCATGGGGTGGTGGTGGG + Intronic
1018215026 6:161518386-161518408 CAGTAGCCAGGCGTGGTGGTGGG + Intronic
1018735124 6:166681928-166681950 CGGGAGAACAGTGCGGTGGTGGG - Intronic
1018845417 6:167552058-167552080 CAGGAAGCAGGTGCTGTGGTGGG + Intergenic
1019044709 6:169135457-169135479 AAGTAGCCAGGTGTGGTGGTAGG + Intergenic
1020059535 7:5141978-5142000 AATCAGCCAGGTGCGGTGGTGGG - Intergenic
1020075456 7:5255120-5255142 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1020190121 7:5989280-5989302 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1020577664 7:9954905-9954927 CAGCAGCAAGGTGCTGGGGCAGG + Intergenic
1020976398 7:15012464-15012486 CAGGAGCAGGGGGCGGTGTGTGG - Intergenic
1021207917 7:17807510-17807532 CTGGTGAAAGGTGCGGTTGTGGG + Intronic
1021696672 7:23282862-23282884 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
1021872572 7:25019172-25019194 CGGGAGGGAGGTGGGGTGGTCGG + Intergenic
1022294992 7:29042460-29042482 CAGGAGCATGCTGCTGTGCTTGG - Intronic
1024722406 7:52152178-52152200 CAGGAGCAATGTGGGGTAGATGG - Intergenic
1025203621 7:56978442-56978464 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
1025668321 7:63598486-63598508 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1026282144 7:68931643-68931665 GATTAGCCAGGTGCGGTGGTGGG - Intergenic
1026801681 7:73404200-73404222 CATTAGCCAGGTGTGGTGGTGGG - Intergenic
1026968710 7:74455113-74455135 CAGGACCAAGGTCCTGCGGTGGG + Intronic
1027017047 7:74785732-74785754 CATGAGCCGGGTGTGGTGGTGGG + Intronic
1028189375 7:87827336-87827358 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1029206089 7:98870095-98870117 CGGGAGCAAGGGGCGGCGGGAGG - Intronic
1030347121 7:108446874-108446896 AATGAGCCAGGTGTGGTGGTGGG - Intronic
1030541283 7:110833288-110833310 AAGTAGCAGGGTGTGGTGGTGGG + Intronic
1030689883 7:112521281-112521303 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1030731400 7:112993783-112993805 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1031998066 7:128245911-128245933 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1032048881 7:128633607-128633629 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1032126589 7:129199326-129199348 CATTAGCTAGGTGTGGTGGTGGG - Intronic
1032191031 7:129766051-129766073 CAGGGGCAAAGTGTGGTGCTTGG - Intergenic
1032300535 7:130682266-130682288 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1032446789 7:131991065-131991087 CAGGACCAGGGAGGGGTGGTGGG + Intergenic
1033023638 7:137752525-137752547 CAGGCCCAAGGTGCGGCGCTGGG - Intronic
1033571681 7:142635692-142635714 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
1034458354 7:151184262-151184284 AAGTAGCCGGGTGCGGTGGTGGG + Intronic
1034952170 7:155306146-155306168 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1035216775 7:157373497-157373519 CATTAGCCAGGTGTGGTGGTGGG - Intronic
1035385599 7:158470550-158470572 CAGGAGCAAAGGGTGGGGGTAGG + Intronic
1036287837 8:7460181-7460203 CAGAAGCAAGGTGAAGGGGTGGG + Intronic
1036333639 8:7851347-7851369 CAGAAGCAAGGTGAAGGGGTGGG - Intronic
1036536094 8:9654151-9654173 GTGGAGCAAGGTGCTGTGATTGG + Intronic
1037139422 8:15502637-15502659 AAGTAGCCAGGTGTGGTGGTGGG - Intronic
1037245441 8:16829646-16829668 AAGTAGCCAGGCGCGGTGGTGGG - Intergenic
1037299981 8:17441592-17441614 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
1037303974 8:17485608-17485630 AATTAGCCAGGTGCGGTGGTGGG - Intergenic
1037375714 8:18225314-18225336 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1040914907 8:52558995-52559017 CAGGAGCAAGGGGCAGGGGAGGG + Intronic
1041027655 8:53703558-53703580 CAGGAGGAAGGTGCTCTGGAAGG - Intergenic
1041045024 8:53880533-53880555 CGGGAGGAAGGAGCGGGGGTGGG - Intronic
1041697672 8:60753771-60753793 AATCAGCCAGGTGCGGTGGTGGG - Intronic
1042133815 8:65615744-65615766 AAGTAGCCAGGTGTGGTGGTGGG + Intronic
1042799014 8:72697481-72697503 TAGCAGCAAGGTGCAGTGGCAGG + Intronic
1042866413 8:73360238-73360260 GAGTAGGAAGGTGTGGTGGTTGG - Intergenic
1042876993 8:73449038-73449060 CAGGAGCAAGGTGCCGGGAGAGG + Intronic
1043467669 8:80528488-80528510 CAGGGACAAGGTGCGGGGGAAGG - Intergenic
1044673537 8:94707740-94707762 AATTAGCCAGGTGCGGTGGTAGG + Intergenic
1046757754 8:117989254-117989276 CAGGAGCCAGGTGAGGCAGTGGG - Intronic
1047245184 8:123136597-123136619 AATTAGCCAGGTGCGGTGGTGGG - Intronic
1047687403 8:127316741-127316763 CAGGAGGGAGGTGGGGGGGTCGG + Intergenic
1048115226 8:131514220-131514242 CAGGAGCAAGGGGTCGGGGTGGG - Intergenic
1048345752 8:133572964-133572986 CTGGAGCAAGGGGCGCTGGAAGG - Intergenic
1049166030 8:141127076-141127098 AAGTAGCCAGGTGTGGTGGTGGG + Intronic
1049884181 9:16817-16839 CAGGAGCTGGGGGTGGTGGTGGG + Intergenic
1049913001 9:287894-287916 CAGGAACAAGCTGCGGTGACTGG - Intronic
1050815827 9:9810042-9810064 CAGGAGGAAGGGGAGGTGGAAGG - Intronic
1052979247 9:34435952-34435974 AATGAGCCAGGTGTGGTGGTGGG - Intronic
1055099274 9:72446554-72446576 AATGAGCCAGGTGCGGTGGCAGG - Intergenic
1055859517 9:80731060-80731082 CAGCAGCTCGGTGGGGTGGTGGG + Intergenic
1056011459 9:82335071-82335093 CAGGAGTTAGGTGAGTTGGTGGG + Intergenic
1056025523 9:82490822-82490844 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1056192704 9:84199589-84199611 AATTAGCCAGGTGCGGTGGTTGG - Intergenic
1057083407 9:92189080-92189102 CTGGAGTGAGGTGCGGGGGTGGG - Intergenic
1057220842 9:93257031-93257053 CTGGAGCCAGGTACGGTGGCAGG - Exonic
1057306174 9:93913277-93913299 CAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1057339684 9:94188825-94188847 CTGGATCAAGGTGTGGTGGATGG - Intergenic
1057564153 9:96153504-96153526 AAGTAACAGGGTGCGGTGGTAGG - Intergenic
1057687873 9:97252371-97252393 AATGAGCCAGGTGTGGTGGTAGG + Intergenic
1057763548 9:97896010-97896032 CAGCGGCAAGGTCCAGTGGTAGG + Intergenic
1060730807 9:126035763-126035785 AATTAGCAAGGTGTGGTGGTGGG + Intergenic
1061414560 9:130439307-130439329 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
1061988109 9:134142162-134142184 CAGGGGCATGGGGCGGGGGTGGG + Intronic
1061993066 9:134170599-134170621 AAGTAGCCAGGAGCGGTGGTGGG - Intergenic
1062193204 9:135258237-135258259 AAGGAGCCGGGTGTGGTGGTGGG - Intergenic
1062244787 9:135560357-135560379 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1062317847 9:135977272-135977294 CTGGTGCAGGGTGGGGTGGTGGG + Intergenic
1062494359 9:136824858-136824880 CAGGAAGAGGGTGCGGTGGCAGG - Intronic
1062752486 9:138265845-138265867 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1203732660 Un_GL000216v2:104779-104801 CAAGAGCAATGTGGGGTGGGGGG + Intergenic
1203574997 Un_KI270745v1:626-648 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1185581835 X:1215776-1215798 AAGGAGCCAGGTGTGGTGGCAGG - Intergenic
1185610300 X:1390442-1390464 CATTAGCAAGGTGTGGTGGCAGG + Intronic
1186359663 X:8827113-8827135 TAGGTGCAAGGTGGGGTGATGGG + Intergenic
1188562936 X:31490411-31490433 CATTAGCCAGGTGTGGTGGTGGG + Intronic
1189102126 X:38201668-38201690 AATTAGCGAGGTGCGGTGGTGGG + Intronic
1189333019 X:40154584-40154606 CTGGAGAAAGGTGGGGTGGGGGG - Intronic
1189382917 X:40514476-40514498 AAGGAGGAAGGTGCAGTTGTAGG + Intergenic
1189407191 X:40735606-40735628 CAGGAGCGAGGGGCGGGGGGAGG + Intronic
1190204955 X:48395119-48395141 CAGGTGCAAGGAAGGGTGGTTGG + Intergenic
1190205581 X:48400284-48400306 CAGGTGCAAGGAAGGGTGGTTGG - Intergenic
1190723678 X:53172178-53172200 CTGGAGCATGATGTGGTGGTGGG + Intergenic
1190792162 X:53710610-53710632 AAGTAGCCAGGTGTGGTGGTGGG + Intergenic
1190854014 X:54275165-54275187 AATTAGCCAGGTGCGGTGGTAGG + Intronic
1191756564 X:64599020-64599042 CAATAGCAAGGTGTGGTGGGAGG - Intergenic
1192006056 X:67213706-67213728 CATTAGCTGGGTGCGGTGGTGGG + Intergenic
1193153099 X:78144828-78144850 AATTAGCCAGGTGCGGTGGTGGG + Intergenic
1193217451 X:78880875-78880897 CAGGATCAAGGTGCAGGGGGAGG + Intergenic
1194719868 X:97327579-97327601 CAGTAGCCAGGTGTGGTGGCAGG - Intronic
1195293508 X:103452126-103452148 AATGAGCCAGGTGCAGTGGTGGG - Intergenic
1195318344 X:103700365-103700387 CATTAGCCAGGTGTGGTGGTGGG + Intergenic
1195435489 X:104838996-104839018 AATGAGCCAGGTGTGGTGGTGGG - Intronic
1195652338 X:107298361-107298383 AAGGAGCAGGGTGTGGGGGTGGG + Intergenic
1196116954 X:112008449-112008471 AATTAGCCAGGTGCGGTGGTGGG + Intronic
1197092241 X:122553143-122553165 CTGGGGCAAGGTGTGGTGGTGGG + Intergenic
1197393190 X:125894380-125894402 AATTAGCAAGGTGTGGTGGTGGG - Intergenic
1197776669 X:130122560-130122582 TAGGAGCAAGGGGGGGTGGGAGG + Intergenic
1197806958 X:130406522-130406544 AAGTAGCCAGGTGTGGTGGTGGG + Intronic
1197884985 X:131209109-131209131 CAGGAGCAAGGTGACAGGGTTGG - Intergenic
1197885211 X:131210908-131210930 CAGGAGCAAGGTGATAGGGTTGG - Intergenic
1198185733 X:134252651-134252673 AAGCAGCAAGATGCGGGGGTGGG - Intergenic
1200401622 X:156023339-156023361 CAGGAGCTGGGGGTGGTGGTGGG - Intergenic
1201868294 Y:18678832-18678854 AATGAGCCAGGTGTGGTGGTGGG + Intergenic
1202587760 Y:26449783-26449805 AATTAGCCAGGTGCGGTGGTGGG + Intergenic