ID: 1142623750

View in Genome Browser
Species Human (GRCh38)
Location 17:1179981-1180003
Sequence CAACTTCGCGGGGGGCGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 243}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142623738_1142623750 4 Left 1142623738 17:1179954-1179976 CCAGCTGCGGATCCCGGAACCGA 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623734_1142623750 15 Left 1142623734 17:1179943-1179965 CCGCGCCGAGCCCAGCTGCGGAT 0: 1
1: 0
2: 1
3: 9
4: 107
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623732_1142623750 22 Left 1142623732 17:1179936-1179958 CCAGCGGCCGCGCCGAGCCCAGC 0: 1
1: 1
2: 4
3: 41
4: 427
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623729_1142623750 28 Left 1142623729 17:1179930-1179952 CCGGCCCCAGCGGCCGCGCCGAG 0: 1
1: 0
2: 0
3: 18
4: 299
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623737_1142623750 5 Left 1142623737 17:1179953-1179975 CCCAGCTGCGGATCCCGGAACCG 0: 1
1: 0
2: 0
3: 2
4: 37
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623731_1142623750 23 Left 1142623731 17:1179935-1179957 CCCAGCGGCCGCGCCGAGCCCAG 0: 1
1: 1
2: 0
3: 31
4: 187
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623740_1142623750 -9 Left 1142623740 17:1179967-1179989 CCGGAACCGATGAGCAACTTCGC 0: 1
1: 0
2: 0
3: 0
4: 27
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623728_1142623750 29 Left 1142623728 17:1179929-1179951 CCCGGCCCCAGCGGCCGCGCCGA 0: 1
1: 0
2: 2
3: 17
4: 309
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623739_1142623750 -8 Left 1142623739 17:1179966-1179988 CCCGGAACCGATGAGCAACTTCG 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623730_1142623750 24 Left 1142623730 17:1179934-1179956 CCCCAGCGGCCGCGCCGAGCCCA 0: 1
1: 0
2: 2
3: 14
4: 214
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243
1142623735_1142623750 10 Left 1142623735 17:1179948-1179970 CCGAGCCCAGCTGCGGATCCCGG 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG 0: 1
1: 0
2: 4
3: 30
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142623750 Original CRISPR CAACTTCGCGGGGGGCGGGG CGG Intronic
900549101 1:3245053-3245075 CAGCATCGCAGGGGGCGGGGTGG + Intronic
902324648 1:15691799-15691821 AAAATTAGCTGGGGGCGGGGAGG + Intronic
902752639 1:18528046-18528068 CCACTGGGCGGGGGGGGGGGGGG + Intergenic
904256804 1:29259580-29259602 GATCTTGGCTGGGGGCGGGGTGG + Intronic
904820582 1:33241089-33241111 CAACTCAGAGTGGGGCGGGGCGG - Intergenic
906715420 1:47965186-47965208 AGATTTGGCGGGGGGCGGGGGGG + Intronic
910127092 1:83854796-83854818 CTAATTTGGGGGGGGCGGGGGGG - Intergenic
914256265 1:145962627-145962649 AAGCTTGGCGGGGGGGGGGGGGG + Exonic
914713330 1:150234810-150234832 CAACTTTTCGGGGGTCGGGTAGG - Intronic
923046359 1:230358584-230358606 CATCTTGTGGGGGGGCGGGGAGG - Intronic
923372333 1:233327325-233327347 CACCTGCGGCGGGGGCGGGGTGG + Intergenic
1065024249 10:21526157-21526179 CGAGTCCGCGCGGGGCGGGGAGG + Intergenic
1066325062 10:34350625-34350647 CATCTTGGCGGGGGGGGAGGGGG + Intronic
1068955276 10:62815326-62815348 CAACTTCGCGGGCGGCGGGCAGG + Intronic
1071379850 10:85047563-85047585 ATACTTCACAGGGGGCGGGGTGG + Intergenic
1071519873 10:86323201-86323223 CAACTTCTCGAGAGCCGGGGTGG + Intronic
1073460274 10:103661899-103661921 AAAGTTGGCGGGGGGCGGGCTGG - Intronic
1074260790 10:111851418-111851440 CATCCTTGCGGGGGGGGGGGGGG - Intergenic
1075117658 10:119640466-119640488 TAACTTGGCGGGGGTGGGGGAGG - Intergenic
1075861305 10:125679139-125679161 CAGCTTGGCGGGGGCGGGGGGGG - Intronic
1076374222 10:129972797-129972819 GAACTTCGCGCGTGGCGGGCCGG - Intergenic
1076659774 10:132047874-132047896 TCAGCTCGCGGGGGGCGGGGCGG - Intergenic
1076664495 10:132078604-132078626 GACCTTCTCTGGGGGCGGGGGGG + Intergenic
1076668301 10:132105081-132105103 CCACTTGGTGGGGGGTGGGGCGG + Intronic
1076749890 10:132537420-132537442 CCGCGGCGCGGGGGGCGGGGCGG + Intergenic
1076761494 10:132608200-132608222 GAACCCCGCGGGGAGCGGGGAGG - Intronic
1077045412 11:542610-542632 GAACCTGGCGGAGGGCGGGGAGG - Intronic
1077317270 11:1925160-1925182 CAACTTTGGGTGGGGCGGGAAGG - Intronic
1077343679 11:2036955-2036977 CAGCTTTGCGGGTGGCGGGAGGG + Intergenic
1078142305 11:8701337-8701359 CAGCTTCCGGGGGGGGGGGGGGG + Intronic
1079437678 11:20474318-20474340 CAAATTCCCAGGGGGAGGGGCGG - Intronic
1079460346 11:20672974-20672996 CAGCTACTCGGGGGGGGGGGGGG - Intronic
1080366739 11:31582880-31582902 CAACTGTGGTGGGGGCGGGGTGG + Intronic
1080783146 11:35449609-35449631 CAAGTTCCCAGGGGGAGGGGAGG - Intronic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1083228767 11:61301745-61301767 CCACCTCCAGGGGGGCGGGGAGG + Intronic
1083460198 11:62806048-62806070 CAACTCAGGGCGGGGCGGGGTGG - Intronic
1083572740 11:63768877-63768899 CCAGCTCGCGGGGGGCTGGGGGG + Intergenic
1084646441 11:70461410-70461432 CAATTTGGCGGGGGTTGGGGGGG - Intergenic
1084889983 11:72232072-72232094 CACCTTCCCTGGGGGAGGGGGGG - Intronic
1085202943 11:74712732-74712754 CAACTTGGAGGTGGGAGGGGAGG - Intronic
1086466814 11:87062419-87062441 CATCTATGCGGGGGGGGGGGGGG - Intronic
1088755502 11:112882109-112882131 CAACTCCTCTGGGGGTGGGGGGG - Intergenic
1090835030 11:130448154-130448176 CATTTACGCGGGGGGGGGGGTGG + Intergenic
1091048480 11:132347218-132347240 CATCTTAGCGGGGGGGGGGGGGG - Intergenic
1091277406 11:134361909-134361931 GAACTTGGCCGGGGGCGAGGAGG - Intronic
1202826665 11_KI270721v1_random:92144-92166 CAGCTTTGCGGGTGGCGGGAGGG + Intergenic
1091477057 12:785402-785424 CCACTTCGAGGGGGTGGGGGGGG - Intronic
1091587817 12:1826403-1826425 CCAGTTGGCGGGGGGGGGGGGGG - Intronic
1092237927 12:6821608-6821630 CAGCTTTGTGGGGGGCGGGGGGG - Exonic
1095697391 12:45157189-45157211 CAATATCGCGGGGGGGGGGGGGG + Intergenic
1096113036 12:49040291-49040313 ACACTTCGCTGGGGGCTGGGGGG - Exonic
1096204211 12:49707466-49707488 AAAGAGCGCGGGGGGCGGGGAGG - Intronic
1096498347 12:52051322-52051344 CAAGGGCGCGGGGGGCGGTGCGG - Intronic
1096770844 12:53934958-53934980 CATATGGGCGGGGGGCGGGGGGG - Intergenic
1096870217 12:54588259-54588281 TCAGTTTGCGGGGGGCGGGGGGG - Intronic
1097267755 12:57755613-57755635 CAACCCCGGGGGGGCCGGGGAGG + Exonic
1097455336 12:59792805-59792827 CAAGTTCCCTGGGGGAGGGGTGG - Intergenic
1098321533 12:69249144-69249166 CAGCTACTCGGGGGGGGGGGGGG + Intronic
1098898112 12:76085036-76085058 CAACGCCGAAGGGGGCGGGGCGG - Intergenic
1099365014 12:81758312-81758334 CATCTTCCCTGGGGGCGGGGTGG + Intronic
1101148262 12:101862214-101862236 CTACTTGGCTGGGGGCTGGGGGG - Intergenic
1102029217 12:109730391-109730413 CACCTGCCTGGGGGGCGGGGGGG + Intronic
1102068609 12:109999463-109999485 GAACGCCGCGGGGCGCGGGGTGG + Intronic
1102197338 12:111034617-111034639 CAACTTCGCGGCGCCCGGGGAGG + Intronic
1102338434 12:112102691-112102713 CTCCATTGCGGGGGGCGGGGGGG - Intronic
1102475436 12:113185502-113185524 CAACTGCGTGGGGGGGGGGGAGG + Intergenic
1102822180 12:115917266-115917288 CGGCTTCGCGCGGGGCTGGGCGG + Intergenic
1102967336 12:117138214-117138236 CAATTTCGGGGGGCGGGGGGTGG + Intergenic
1103800645 12:123534640-123534662 CTCCTGCGTGGGGGGCGGGGAGG - Intergenic
1104756795 12:131274358-131274380 CAGCTTGGCAGGGGGAGGGGAGG - Intergenic
1106452425 13:29895052-29895074 CTACTTGGCGGGGGGCGGGGGGG + Intergenic
1106956272 13:34942463-34942485 CATCTCCGCGGGGGGCGGGCCGG + Exonic
1109025173 13:57146302-57146324 CTACTTGGGGTGGGGCGGGGGGG - Intronic
1109026159 13:57152875-57152897 CTACTTGGGGGGGGGGGGGGGGG - Intronic
1109027151 13:57159446-57159468 CTACTTGGGGGGGGGGGGGGGGG - Intergenic
1109028137 13:57166011-57166033 CTACTTGGGGGGGGGGGGGGGGG - Intergenic
1110064560 13:71087515-71087537 CCACTGCGCGGGCGGGGGGGGGG - Intergenic
1112084802 13:96019114-96019136 CTACATAGCGGGGGGGGGGGGGG + Intronic
1112330883 13:98476243-98476265 CCACTCTGCAGGGGGCGGGGGGG - Intronic
1113083015 13:106536343-106536365 CACCTTCCCGGGGGGCCAGGAGG - Intergenic
1114554212 14:23552116-23552138 CAATTTCGCGGGGGGAGATGGGG - Intronic
1115522419 14:34246220-34246242 CAAGAATGCGGGGGGCGGGGGGG + Intronic
1115654734 14:35432375-35432397 CTACTTGGTGGGGGGTGGGGGGG + Intergenic
1117315586 14:54567847-54567869 AAACTTTGGGGCGGGCGGGGCGG + Exonic
1117802992 14:59464408-59464430 CAGCTGCGCGGGGTCCGGGGAGG + Exonic
1117920261 14:60721596-60721618 CAACTGGGCCGGCGGCGGGGTGG + Intronic
1118069946 14:62235383-62235405 CATCTTCCGGTGGGGCGGGGTGG - Intergenic
1118220542 14:63851967-63851989 CTACTAAGCGGGGGGGGGGGGGG + Intergenic
1118911022 14:70062102-70062124 CTTTTTGGCGGGGGGCGGGGGGG + Intronic
1119991874 14:79207307-79207329 CATGTTCGCTTGGGGCGGGGTGG - Intronic
1120359845 14:83485429-83485451 GAACATGGCGGGGGGGGGGGGGG - Intergenic
1121013583 14:90535357-90535379 CAACTTCGGGCAGGGTGGGGTGG - Exonic
1122417672 14:101558115-101558137 CAACTTGGAGAGAGGCGGGGAGG - Intergenic
1122688849 14:103522248-103522270 CGGCTGCGCGGGGGGAGGGGGGG + Intronic
1122993263 14:105248851-105248873 CATCTTCGCGGGCGGGGCGGCGG - Exonic
1123038708 14:105481724-105481746 CAGCTTGGCGGGGCGGGGGGCGG + Intergenic
1123433507 15:20237829-20237851 CAGCTTCGTGGGGGGCGGCAGGG + Intergenic
1123696220 15:22880833-22880855 CCACTTGGCGGGGGTGGGGGCGG + Intronic
1124155918 15:27225332-27225354 CCACGTGGAGGGGGGCGGGGAGG - Intronic
1125556614 15:40591025-40591047 TAACTTGGCTGGGGGCGGGGCGG + Intergenic
1128841183 15:70853218-70853240 CTGCCTTGCGGGGGGCGGGGGGG - Intronic
1131366115 15:91842682-91842704 TTACTGGGCGGGGGGCGGGGGGG - Intergenic
1132167536 15:99610421-99610443 CAATTTCGGGGGGGGGTGGGGGG - Intronic
1132672931 16:1109100-1109122 AAACTGGGCGGAGGGCGGGGCGG + Intergenic
1133641108 16:7718231-7718253 TCACTTTGCGGGGGGCGGGGGGG + Intergenic
1133982497 16:10643748-10643770 CAATTTCACGCCGGGCGGGGTGG + Intronic
1133991313 16:10709668-10709690 CAATATCACGGGGGGGGGGGGGG + Intergenic
1134915172 16:18063287-18063309 CAGCTTGGCGGGGTGGGGGGTGG - Intergenic
1135162405 16:20108919-20108941 AAACATCGCAGGGGTCGGGGAGG - Intergenic
1135511082 16:23083687-23083709 AAACCTGGCGGGGGGGGGGGGGG + Intronic
1137041310 16:35615499-35615521 CAGCTTGGCGGGGGGGGGGGGGG - Intergenic
1139469448 16:67170484-67170506 CAGCTGCGGCGGGGGCGGGGCGG - Intronic
1139853812 16:69965541-69965563 CAACCAGGCGTGGGGCGGGGTGG - Intergenic
1139882790 16:70188454-70188476 CAACCAGGCGTGGGGCGGGGTGG - Intergenic
1140335529 16:74101362-74101384 GAACTTCCTGGGGGGCTGGGGGG + Intergenic
1140369720 16:74407065-74407087 CAACCAGGCGTGGGGCGGGGTGG + Intergenic
1140812779 16:78594432-78594454 CAATTTGGCGGGGGGGGGGGGGG - Intronic
1141125547 16:81398170-81398192 CAAGATCACGGGGGGTGGGGGGG + Intergenic
1141132436 16:81445130-81445152 CACCTTCCCGGGGGGTGGGGGGG + Intergenic
1141301159 16:82816797-82816819 AAACTTCGGGGGGCGGGGGGTGG + Intronic
1142125828 16:88409857-88409879 CATCTTGGCCGGGGGGGGGGGGG + Intergenic
1142384970 16:89758142-89758164 CAACTTCGGGCTGGGCGTGGTGG - Intronic
1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG + Intronic
1143495012 17:7307810-7307832 GAACTGCGCGGGGGTCGGGGAGG + Intronic
1144703243 17:17351915-17351937 CAAGGTGGCGGGGGGCGGGGTGG - Intergenic
1146279918 17:31538312-31538334 AAACTTGGTGGGGGGCAGGGGGG - Intergenic
1147178456 17:38671120-38671142 CAACCTGGAAGGGGGCGGGGTGG - Intergenic
1148619275 17:49022411-49022433 CAACAGCGGGAGGGGCGGGGCGG - Intronic
1151729845 17:75904774-75904796 CAGCTCTGCGGGGGGGGGGGGGG - Intronic
1151945671 17:77318672-77318694 CATCTTCCTGGGGGGTGGGGAGG - Intronic
1152609905 17:81310300-81310322 CAGCTGCGCAGGGGCCGGGGCGG + Intergenic
1152720855 17:81923269-81923291 GAACTGGGCCGGGGGCGGGGGGG - Intronic
1152870641 17:82751585-82751607 CAACACGCCGGGGGGCGGGGCGG - Intergenic
1153201859 18:2655585-2655607 CAACTTCGCGAGGGCCGAGGGGG + Intergenic
1153489091 18:5629822-5629844 CAACTCCGGCGAGGGCGGGGAGG + Intronic
1153743277 18:8151477-8151499 CAGCTTGGTGGGGGGCGGGGGGG - Intronic
1159117068 18:64127074-64127096 TTACTTGGCAGGGGGCGGGGAGG - Intergenic
1159961112 18:74556396-74556418 TAACAGCGCCGGGGGCGGGGAGG - Exonic
1160163703 18:76493315-76493337 TCATTCCGCGGGGGGCGGGGGGG + Intronic
1160947909 19:1652117-1652139 CAACTTCGCGCGGCGCCGGGGGG - Intronic
1161058678 19:2203346-2203368 AAACTTTGCGGGGGCCGAGGCGG - Intronic
1161482247 19:4516995-4517017 CAGCTGCGGTGGGGGCGGGGCGG - Intronic
1162079030 19:8208219-8208241 CAGGGGCGCGGGGGGCGGGGCGG - Intronic
1163135798 19:15310365-15310387 CTCCTTCGGGGGGGGGGGGGGGG - Intronic
1164229240 19:23273592-23273614 CAGCTTCTCGGGGGCCGGGGGGG + Intergenic
1164498672 19:28793557-28793579 CAGCTTCTCGGGGGCCGCGGAGG - Intergenic
1165504267 19:36214921-36214943 CAAGTTCGCGGGGGGAGGGGAGG + Exonic
1166189309 19:41165249-41165271 CATCTTCGGGCGGGGTGGGGTGG - Intergenic
1166630467 19:44401960-44401982 AAACATGGTGGGGGGCGGGGAGG - Intergenic
1167267641 19:48491431-48491453 CATCTCCGGGGGTGGCGGGGTGG + Exonic
1167438071 19:49491405-49491427 AAACTGCGGGGGGGGGGGGGGGG - Exonic
1168264922 19:55217451-55217473 TAACTTCGGGCGGGGCGCGGTGG + Intergenic
1168318345 19:55493972-55493994 CAAGTTCGGCGGGGGCGGGGGGG + Intronic
925008865 2:467388-467410 CAGCTCCGGGCGGGGCGGGGAGG - Intergenic
931005291 2:57843623-57843645 CTGGTTGGCGGGGGGCGGGGGGG + Intergenic
934560708 2:95311858-95311880 CAACTTCTCGGGGATGGGGGTGG + Intronic
937388109 2:121455707-121455729 AAACTTAGCTGGGGGCGTGGTGG + Intronic
939800107 2:146697851-146697873 AAAGGTGGCGGGGGGCGGGGGGG + Intergenic
941379609 2:164776599-164776621 CAGGTTGGCGGTGGGCGGGGAGG - Intronic
941904999 2:170712010-170712032 AACCGTGGCGGGGGGCGGGGAGG - Intergenic
942813314 2:180022096-180022118 CCACATCGCGGGGGGTGGGAGGG + Intergenic
946386825 2:219388432-219388454 CAGCCTAGCGAGGGGCGGGGCGG - Intronic
946416428 2:219542225-219542247 CAACGGGGCGGGGGGTGGGGGGG + Intronic
946857731 2:223969557-223969579 CTATTTAGCGGGGGGGGGGGGGG - Intergenic
947382527 2:229559090-229559112 CAACTTTGTGGGGGGTGTGGTGG + Intronic
948402164 2:237692140-237692162 GAACTGCGTGGGGGGCGGGGCGG + Intronic
948614547 2:239190161-239190183 CACCTTCACGGGGCGGGGGGGGG + Intronic
948682536 2:239645684-239645706 CAGATCGGCGGGGGGCGGGGGGG - Intergenic
1168756771 20:324177-324199 CCGCGGCGCGGGGGGCGGGGTGG - Intergenic
1169224464 20:3847343-3847365 CAGGTCCGCGGAGGGCGGGGAGG - Intronic
1172020199 20:31908576-31908598 CCCCTTCGCTGGGGGTGGGGTGG - Exonic
1175267219 20:57710043-57710065 CCACCGCGCGGGGGCCGGGGAGG + Intronic
1175847258 20:62065433-62065455 CAGCTTCGCGGCGGGCGGCGCGG + Exonic
1176666179 21:9689567-9689589 CCACATCGGGTGGGGCGGGGGGG + Intergenic
1179683211 21:43038817-43038839 CAAACTCGGGGTGGGCGGGGAGG + Intergenic
1180182870 21:46125640-46125662 CAGCATTGCGGGGGGCCGGGCGG + Intronic
1180744615 22:18078935-18078957 CAACCTTGGGCGGGGCGGGGAGG - Intronic
1181291564 22:21798301-21798323 GCACTTTGCGGGGGGCGTGGGGG + Intronic
1181570971 22:23767716-23767738 CATCTTGGCGGGGGGAGGGGTGG - Intronic
1181737993 22:24897090-24897112 CAACTGCACGCGGGGCGTGGTGG + Intronic
1182313277 22:29424831-29424853 CAATTTTGCGGGGGGGGGGGTGG - Intergenic
1183010722 22:34944426-34944448 CATGGTGGCGGGGGGCGGGGGGG - Intergenic
1183474915 22:38030861-38030883 CAACTGAGCTGGGGGTGGGGTGG - Intronic
1185261210 22:49864939-49864961 TGACTTCACGGGGGGGGGGGGGG - Intronic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
1185373058 22:50469745-50469767 CAGCTTCTTGGGGGCCGGGGTGG - Intronic
950177203 3:10883043-10883065 CAAGGGGGCGGGGGGCGGGGAGG + Intronic
952616398 3:35278451-35278473 CAAGTTCCCAGGGGGAGGGGTGG + Intergenic
955413286 3:58669880-58669902 CAACTTCACAGGGTGCGGTGGGG - Intergenic
957314081 3:78555188-78555210 CAACTTCCTGGGTGGTGGGGAGG + Intergenic
959223573 3:103553169-103553191 GAACTTTGTGGGGGGCGGGGTGG + Intergenic
962154005 3:132924886-132924908 CTCCTTTGCGGGGGGAGGGGGGG - Intergenic
964214166 3:154260713-154260735 CAAATTCAGGGGTGGCGGGGGGG + Intergenic
964889123 3:161516846-161516868 CAATATCACGGGGGGGGGGGGGG + Intergenic
964889635 3:161519660-161519682 CAATATTACGGGGGGCGGGGTGG + Intergenic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968453409 4:685697-685719 CTCCTTCTCGGGTGGCGGGGCGG + Intronic
971358561 4:25915844-25915866 CAACTTGGGATGGGGCGGGGGGG + Intronic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
976375625 4:84342283-84342305 CAAATTCCCAGGGGGAGGGGTGG + Intergenic
976765482 4:88593169-88593191 CCACTTCGCGGAGGCCGGGCCGG + Intronic
977471773 4:97452129-97452151 CAGCTGTGCTGGGGGCGGGGGGG - Intronic
983119066 4:163858088-163858110 CAACTCCGGGGGGTGGGGGGGGG + Intronic
987360707 5:17103962-17103984 GCACTTTGCGGGGGGCGGTGGGG + Intronic
988525865 5:31986644-31986666 AGCCTTTGCGGGGGGCGGGGGGG + Intronic
989276832 5:39599087-39599109 CAAGTTCCCGCGGGGAGGGGCGG - Intergenic
992627783 5:78649718-78649740 TGACTGGGCGGGGGGCGGGGGGG - Intronic
994350661 5:98742488-98742510 CAAGTTCCCGGGGGGAGGGTGGG + Intergenic
997521177 5:134525489-134525511 CAACTGGGCGGGGGGTTGGGGGG + Intronic
997584094 5:135034447-135034469 CGAGGCCGCGGGGGGCGGGGAGG - Intronic
1001919595 5:175589510-175589532 CAAGTTTGCGGGGGGTGGGGGGG + Intergenic
1002527239 5:179821427-179821449 CAACAGCGCGGGGGGTGGAGCGG - Intronic
1002941586 6:1721179-1721201 AAAGTTTGCGGGGGGTGGGGAGG + Intronic
1004863560 6:19832144-19832166 CAGCTACTGGGGGGGCGGGGTGG - Intergenic
1005370497 6:25127265-25127287 CAACTTTGAGGGGGACGGAGTGG + Intergenic
1005715669 6:28544602-28544624 GGAATTGGCGGGGGGCGGGGGGG + Intergenic
1005737105 6:28758004-28758026 GAAATGCCCGGGGGGCGGGGGGG + Intergenic
1009367063 6:62864033-62864055 CCACATCGCGGGGTGGGGGGGGG - Intergenic
1009940089 6:70280996-70281018 CAACTTACCGGGGGGCCCGGGGG + Exonic
1010126700 6:72440818-72440840 CTACTTTGTGGGGGGTGGGGGGG - Intergenic
1013491059 6:110646589-110646611 CAACGGCGGAGGGGGCGGGGAGG + Intronic
1013580907 6:111533635-111533657 CATCTTAGCTGTGGGCGGGGGGG - Intergenic
1014802241 6:125790565-125790587 GGAGGTCGCGGGGGGCGGGGAGG + Intronic
1017820602 6:158046377-158046399 CATCTTCACAGGGGGCCGGGAGG + Intronic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1020160489 7:5767475-5767497 CAACTTGGTGGGGGGTGAGGAGG - Intronic
1020296854 7:6764184-6764206 CAAGGTCGGGGGGGTCGGGGGGG + Intronic
1022007371 7:26278240-26278262 CAGCTACTCGGGGGGAGGGGGGG + Intergenic
1022517199 7:30983655-30983677 CAACTGAGCGGGGGGGTGGGGGG + Intronic
1023395149 7:39745316-39745338 CAATTTCCCGGGGGGCAGGGTGG + Intergenic
1024034418 7:45495345-45495367 CAAGTTCCCGTGGGGAGGGGCGG - Intergenic
1025126084 7:56346200-56346222 CAAAGTTGCGGGGGGCGGGGGGG + Intergenic
1027702189 7:81483464-81483486 CAACTTCGTGGTGGCGGGGGGGG - Intergenic
1028407600 7:90493136-90493158 TAACTTTGCAGGGTGCGGGGGGG + Intronic
1028987359 7:97018737-97018759 AAGGTTTGCGGGGGGCGGGGGGG - Intergenic
1029110285 7:98210591-98210613 AAACATCCCGGGCGGCGGGGCGG + Intergenic
1029384061 7:100232048-100232070 CCACCTGGCAGGGGGCGGGGTGG + Intronic
1029640645 7:101817058-101817080 AAACTTGGCGAGGGGCGGCGGGG + Intronic
1032253050 7:130274148-130274170 CAACTCGGCGCGGGGAGGGGGGG - Intronic
1033983744 7:147197334-147197356 ACACTCCACGGGGGGCGGGGGGG - Intronic
1034288743 7:149910206-149910228 GAACTTTGCGGGGTGGGGGGCGG + Intergenic
1034453465 7:151150628-151150650 GAACTTGGCAGGGGGTGGGGCGG - Intronic
1034662334 7:152782661-152782683 GAACTTTGCGGGGTGGGGGGCGG - Intronic
1038436958 8:27543009-27543031 GAACTGGGCGGGGGGCGGGGGGG - Intronic
1039953634 8:42191093-42191115 CAACCTAGCGGGGGCTGGGGGGG - Intronic
1042402035 8:68360903-68360925 AAAATTCGCAGGGGGTGGGGTGG - Intronic
1043591894 8:81842318-81842340 GAACTGGGCGGGGGGGGGGGGGG + Intronic
1045068691 8:98477694-98477716 ACACTTGGCGGGGGGGGGGGGGG + Intronic
1049663049 8:143829048-143829070 CAGCTTCCGGCGGGGCGGGGCGG - Intronic
1050243337 9:3660477-3660499 CAACTTTGCTGGTGGCGGTGGGG - Intergenic
1051418925 9:16871290-16871312 CAGCTCCCCGGGGGGGGGGGGGG - Intergenic
1052923514 9:33992643-33992665 CAACTTATCGGGCGGAGGGGGGG + Intronic
1056643331 9:88388793-88388815 CATGTTGGCGGGGGGCGGCGGGG - Intronic
1057072902 9:92115445-92115467 CACCTCCGCAGAGGGCGGGGCGG + Intergenic
1060402730 9:123357620-123357642 CATGGTGGCGGGGGGCGGGGTGG + Intronic
1060744152 9:126119103-126119125 CATTTTGGCGGGGGGCTGGGGGG + Intergenic
1061715334 9:132515089-132515111 CCACTTGGCGGGGGTGGGGGAGG + Intronic
1062372209 9:136245785-136245807 CAACATGGCGGCGGCCGGGGCGG - Exonic
1203659919 Un_KI270753v1:32194-32216 CCACATCGGGTGGGGCGGGGGGG - Intergenic
1185923687 X:4123061-4123083 CATCTTGGTGGGGGGTGGGGGGG + Intergenic
1186878159 X:13837702-13837724 CAAGTTGGTGGGGGGGGGGGGGG + Intronic
1187332649 X:18354723-18354745 CGGCCGCGCGGGGGGCGGGGCGG - Exonic
1188383861 X:29532018-29532040 TATCTTCGCGGGGAGAGGGGGGG + Intronic
1188535325 X:31190582-31190604 CAACTGGGCGGGGGGGGGGGGGG + Intronic
1190845022 X:54183283-54183305 GCACTCCGCGGGGGGCGAGGGGG + Intergenic
1192366433 X:70477605-70477627 AAACGTTGCGGGGGGTGGGGTGG - Intronic
1192931815 X:75814500-75814522 CAGCTTGGTGGGGGGTGGGGGGG + Intergenic
1195025516 X:100873030-100873052 CACCTGGTCGGGGGGCGGGGGGG + Intronic
1195051040 X:101097409-101097431 AAACTTGGCGGGGGGCGGGGAGG - Intergenic
1195431780 X:104797188-104797210 TTACTTTGCGGGGGGGGGGGGGG - Intronic
1197333255 X:125180207-125180229 AAATTTCCCGGGGGGGGGGGGGG - Intergenic
1197333522 X:125182438-125182460 CATCTTTTCGGCGGGCGGGGGGG + Intergenic
1197758933 X:130014499-130014521 CATCTTGGCGGGGTGCGGTGGGG - Exonic
1197774541 X:130110742-130110764 AAACGGGGCGGGGGGCGGGGTGG + Intergenic
1198374058 X:136020168-136020190 CAACATGGCGGGGGAAGGGGGGG - Intronic
1199286990 X:146064809-146064831 CTACATTGCGGGGGGTGGGGGGG - Intergenic
1201867839 Y:18673575-18673597 GAACTGCGCGGGGGTGGGGGGGG - Intergenic