ID: 1142629688

View in Genome Browser
Species Human (GRCh38)
Location 17:1216752-1216774
Sequence CTCTGGGTCTGGTGGCCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142629680_1142629688 -1 Left 1142629680 17:1216730-1216752 CCTGTCTAAAGACCCTGGGGAAC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG 0: 1
1: 1
2: 1
3: 22
4: 192
1142629676_1142629688 5 Left 1142629676 17:1216724-1216746 CCTCTGCCTGTCTAAAGACCCTG 0: 1
1: 0
2: 0
3: 11
4: 202
Right 1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG 0: 1
1: 1
2: 1
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142629688 Original CRISPR CTCTGGGTCTGGTGGCCAAA GGG Intronic
900897627 1:5494795-5494817 CTCTGGGTTGGGAGGCCACACGG - Intergenic
901679376 1:10904273-10904295 CCCAGTGTCTGGAGGCCAAACGG + Intergenic
902817898 1:18926538-18926560 CTCTGAGGCTGGTGGCCAGGAGG + Intronic
902984427 1:20146921-20146943 CTCTGGCTCTGATGGCCCCAGGG - Intronic
903922659 1:26811812-26811834 TTGTGGGTCTGGTGGCAACAAGG - Intergenic
904197544 1:28796959-28796981 CTCTGGGTCTGGTAGGCAAATGG + Intergenic
904456440 1:30651065-30651087 CTGTGGGTCTGGGTGCCAAGTGG - Intergenic
906281578 1:44558051-44558073 CCCTGAGGCTGTTGGCCAAAAGG - Intronic
906326742 1:44850905-44850927 CTGTGGCTTTGGAGGCCAAAAGG + Exonic
908393750 1:63706470-63706492 TTTTTTGTCTGGTGGCCAAAAGG - Intergenic
912442037 1:109706481-109706503 CACTGGGCCTGATGGTCAAAAGG + Intronic
913997967 1:143667042-143667064 TTCTGTGTCTGGTGGTCAAGTGG - Intergenic
917302469 1:173590755-173590777 CAGTGGGTATGCTGGCCAAAGGG + Intronic
920556868 1:206910229-206910251 TTCTGGGGCTGGTGGTGAAAAGG - Exonic
921441015 1:215186136-215186158 GGCTGGGTATGGTGGCAAAATGG + Intronic
923261393 1:232271327-232271349 TTCTGGGTCTTGTGGACATAAGG - Intergenic
924307397 1:242704425-242704447 GGCTGGGTGTGGTGGCCTAAAGG + Intergenic
1062894044 10:1089379-1089401 CTCTGGGCCTGGGGGCCTCAGGG + Intronic
1063187752 10:3665985-3666007 CTCAGGGTCTGGTGGCCCCAGGG - Intergenic
1064300205 10:14116579-14116601 CACAGGGTCTGGGGGCTAAAAGG + Intronic
1065790378 10:29254821-29254843 CTCTGGGGCTGGTGGCCTTTTGG - Intergenic
1066336537 10:34483609-34483631 ATCTGGGGCTGTTGGCCATATGG - Intronic
1067407171 10:46033660-46033682 CTCTGGGGCTGCCAGCCAAAGGG - Intronic
1069922197 10:71822614-71822636 CTCTGTGTTTGGTGTCTAAATGG - Intronic
1069990340 10:72311358-72311380 TTCTGGGTCTTTTGGCCACACGG - Intergenic
1072553085 10:96493968-96493990 CTCTGAGTCTTGGAGCCAAAAGG - Intronic
1073300879 10:102470423-102470445 CTGTTGGGCTGATGGCCAAAGGG - Intronic
1074719802 10:116254606-116254628 AGCTGGCTCTGGTTGCCAAAGGG - Intronic
1076114566 10:127886406-127886428 CTCAGGGGCTGCTGGCAAAAGGG + Intronic
1076159786 10:128234897-128234919 CCCTGGGCCTGGAGGCCAGATGG + Intergenic
1076516046 10:131044990-131045012 CTCAGGGATCGGTGGCCAAATGG - Intergenic
1078308335 11:10213638-10213660 CTATTGGTCTAGAGGCCAAAAGG + Intronic
1078898626 11:15621094-15621116 CTATAGGTCTATTGGCCAAAGGG - Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079294567 11:19221518-19221540 TTCTGTGGCTGGTAGCCAAAGGG - Intergenic
1084009598 11:66340209-66340231 CTCTGGGTCTCGGGGCAGAATGG - Exonic
1085016765 11:73178913-73178935 CTCTGGGTCTGGTTACCTAGAGG + Intergenic
1085033391 11:73286136-73286158 CTCTGGGTCAGGTGACCTTAAGG + Intronic
1088009865 11:104986697-104986719 CTGTGGTGCTGGTGGCCACAGGG + Intergenic
1090977100 11:131687767-131687789 CCCTGGGTCTGGTGGCGGAAGGG + Intronic
1097079753 12:56421399-56421421 CTCTGGGGCTGGTGGCTGAGCGG - Exonic
1099016022 12:77345249-77345271 CTCTGGATGTGGAGGCCACATGG + Intergenic
1099729633 12:86484300-86484322 CTCTTGGCCTGGTGGCCAGCTGG - Intronic
1099815952 12:87647871-87647893 CTCTGGGGCTGGTTGCGAACTGG + Intergenic
1104965595 12:132507580-132507602 CCCAGGGTCTGGTAGCCCAAAGG + Intronic
1106763777 13:32893593-32893615 GTCTGGGTCGGGTGTACAAATGG + Intergenic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1108763934 13:53603899-53603921 ATCTAGCTCTGGTGTCCAAAAGG - Intergenic
1113905278 13:113816614-113816636 CGCGGGGTCTGGTGGCCACGGGG - Exonic
1113990243 14:16022962-16022984 CTCTGGGTGTGTGGGCCAAGAGG + Intergenic
1114364749 14:22014031-22014053 CTCTGGCACTGCAGGCCAAAAGG - Intergenic
1114769887 14:25417015-25417037 CTCTGGGTCTGCTGGTGACACGG + Intergenic
1118641737 14:67798878-67798900 GGCGGGGCCTGGTGGCCAAAAGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1121088795 14:91167204-91167226 CTCTGGGTATGGTGGGAGAAGGG - Exonic
1122285910 14:100652533-100652555 CTGTGGGTCTAGTGGCAACAGGG + Intergenic
1122288700 14:100667993-100668015 CTCTGGGTCCTGAGGCCAAGCGG - Intergenic
1124124803 15:26929555-26929577 CTCTGGGACTGGGGTCCTAATGG + Intronic
1127178997 15:56395103-56395125 GTCAGGGTGTGGTGGCTAAAGGG - Intronic
1127958600 15:63874025-63874047 GTCTGGGTCTGGGGGAAAAAAGG - Intergenic
1127958815 15:63875835-63875857 CACTGGGTCTGGTGCCCAATCGG - Intergenic
1129348108 15:74937579-74937601 CTCTCGGTCAGGTGGCCGCAGGG + Intronic
1130991563 15:88878919-88878941 CTGTGGGTTTGGTGGCCACCTGG - Intronic
1133285564 16:4689008-4689030 CTCGGAGCCTGGTGGCCACAGGG - Exonic
1133915395 16:10105064-10105086 CTCTGGGTCTGGAGCCGAACTGG + Intronic
1138250051 16:55495069-55495091 CACAGGGTCTGCTGGCCAATGGG + Intronic
1139390611 16:66604804-66604826 GTCGGGGTCTGGGGGCCACATGG - Exonic
1141685823 16:85569355-85569377 CCCTGGGCCTGGGGGCCAAGTGG + Intergenic
1141964777 16:87434462-87434484 CGCTGGGTCTGGAGGCCACCTGG + Intronic
1142212627 16:88815763-88815785 CTCCTGCTCTGGTGGCCAAGGGG - Intronic
1142629688 17:1216752-1216774 CTCTGGGTCTGGTGGCCAAAGGG + Intronic
1142969394 17:3601120-3601142 CACCGGGTTTGGTGGCCAGAAGG - Intergenic
1143119821 17:4599709-4599731 CTCTGGTTCTGGCTGCCAAGGGG - Intronic
1143674008 17:8417586-8417608 CTCTGTGTATGGTGATCAAATGG + Intronic
1144724313 17:17494047-17494069 CACTGAGTCTGGTGACAAAATGG + Intergenic
1145064863 17:19755514-19755536 CACTGGTTTTGGTGGCCACAGGG + Intergenic
1148045207 17:44739484-44739506 CGCTGGCTTTGGTGGCCCAAAGG + Intronic
1148477310 17:47937180-47937202 ACCTGGCTCTGGTGACCAAATGG - Intergenic
1149407425 17:56368056-56368078 CTCTGGATCTGATGGCAGAATGG - Intronic
1150264107 17:63820786-63820808 CCCAGGGTCTGGTGGGTAAATGG - Intronic
1150525378 17:65917056-65917078 CTCTGAGTCTGGCAGCCTAATGG + Intronic
1150577154 17:66440629-66440651 GTCTGGGACTGGTGGTCAAGGGG + Intronic
1151890717 17:76949166-76949188 ATCTGGGCCAGGTGGCGAAAGGG + Exonic
1151932609 17:77242028-77242050 TTCTGGTGATGGTGGCCAAAGGG - Intergenic
1152555905 17:81053126-81053148 CTCTGGGTCTGTTTGCCCGACGG - Intronic
1152923396 17:83076993-83077015 CTCGGGGTCTGGTGGTACAAGGG + Intergenic
1152942132 17:83178298-83178320 CTCTTGGTCAGGTGGCCCAGGGG - Intergenic
1155488335 18:26371702-26371724 CTCTAGGTCTGGTGAACAGATGG + Intronic
1155860839 18:30897359-30897381 CTCTGAGTTTGGTGGAAAAAAGG + Intergenic
1156511539 18:37641034-37641056 GTCTGGGTTTGGTGTCTAAAAGG + Intergenic
1156890312 18:42183427-42183449 GTCTGGGTCTGGGTGCCCAAGGG - Intergenic
1157196050 18:45621147-45621169 CTCTCCCTCTGGTGGCCAAGAGG - Intronic
1157222640 18:45838646-45838668 CTCCGGCTCTGGCGTCCAAAGGG + Intronic
1157880684 18:51318479-51318501 CTCTGGCTCTAGTGCCCACACGG + Intergenic
1158091233 18:53716156-53716178 GTCAGGGGCTGGTGGGCAAAGGG - Intergenic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1159951315 18:74486356-74486378 CTTTGGGTCTGGTGCCCACCTGG - Intergenic
1160880207 19:1316200-1316222 GTCTGGGTCTGATGCCCCAACGG + Intergenic
1163556703 19:17997404-17997426 CTGGGGGTCTAGTGGCCACAGGG - Intronic
1163580526 19:18136038-18136060 AGCTGGGTCTGGTGCCCATATGG + Intronic
1163930330 19:20384213-20384235 CTCTGAGTTTGGTAACCAAAAGG - Intergenic
1165756488 19:38296208-38296230 TGCTGGGTCTGGAGGCCAGAGGG - Intronic
1166214471 19:41326174-41326196 CGCTGGGTATGGAGGCCAACAGG + Intronic
925282925 2:2697326-2697348 CTTAGGGTATGCTGGCCAAAGGG - Intergenic
926968014 2:18437416-18437438 GCCTGGGTCAGGTGGCCAAGAGG + Intergenic
927646076 2:24877775-24877797 CTCTCTGTCTGGTGGTCAGATGG - Intronic
928077767 2:28280812-28280834 CTTTGTTTCTGGAGGCCAAATGG - Intronic
929067749 2:37996951-37996973 CTCTGGGTCAGGAGGCCAGTTGG + Intronic
929450093 2:42030994-42031016 CTCTGGGTCTGCTGGGCACTGGG - Intergenic
931445365 2:62322773-62322795 CTCTGGGCCTGGTAGTTAAAGGG - Intergenic
931746662 2:65296997-65297019 ATCTGGGTCCTGTGGTCAAATGG + Intergenic
933938454 2:87225865-87225887 GGCTGGGTCTGGTGGGCACATGG - Intergenic
933993889 2:87653414-87653436 CTCTGTGTCTGGTGGCTATAGGG + Intergenic
935349458 2:102141280-102141302 CTCTGGGGCTGAGGCCCAAAAGG - Intronic
936299974 2:111297469-111297491 CTCTGTGTCTGGTGGCTATAGGG - Intergenic
936354684 2:111739909-111739931 GGCTGGGTCTGGTGGGCACATGG + Intergenic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
940491518 2:154368174-154368196 CTCTGGCTCTGATGACAAAAAGG + Intronic
942925856 2:181431091-181431113 TTCTGTGTCTGTTGTCCAAATGG + Intergenic
944477324 2:200120214-200120236 CTTTGGGTCTGGTGGGTAAAAGG + Intergenic
946128450 2:217585447-217585469 CTCCAGGTCTGGTGCCCAATGGG - Intronic
949075603 2:242055594-242055616 CTCTGGGCCTGGTCGCCCAAGGG + Intergenic
1169132232 20:3172373-3172395 CTCTGGTTCTGGGGACCAAGAGG - Intronic
1169254186 20:4084829-4084851 CTCTGGGTCTGATGGTCAGGAGG + Intergenic
1171771631 20:29326709-29326731 CTCTGGGTGTGTGGGCCAAGAGG - Intergenic
1171813585 20:29763942-29763964 CTCTGGGTGTGTGGGCCAAGAGG - Intergenic
1173788550 20:45812775-45812797 CCCGGGGTCCGGTGGGCAAAAGG + Exonic
1175317129 20:58056399-58056421 TTCTGGGTCTGCTTTCCAAAAGG + Intergenic
1179085594 21:38214880-38214902 GTCTGGATCAGGTGGCAAAATGG - Intronic
1179655500 21:42842041-42842063 CCCGGGGTCAGGTGGCCACAGGG - Intergenic
1179985640 21:44919152-44919174 CCCGGGGTCAGGTGGCCACAGGG + Intronic
1180317029 22:11284564-11284586 CTCTGGGTGTGTGGGCCAAGAGG - Intergenic
1181463061 22:23096630-23096652 CTCAGGGTGTGGAGGCCACAGGG + Intronic
1181763074 22:25071362-25071384 CTCTGGGACTGGCGGCTAAAAGG - Intronic
1182246509 22:28962440-28962462 CTCTGGGTCAGCTCTCCAAAAGG + Intronic
1183779343 22:39988800-39988822 CTTCTGGTCTGGTGGCCTAAGGG + Intergenic
1184668673 22:46001673-46001695 CTCTGGGGCTGGTGGCCAAACGG - Intergenic
1185285074 22:49996455-49996477 CTCAGTGGCTGGTGGGCAAAGGG + Exonic
951447436 3:22798960-22798982 CTCTGTGTCTGGAGGCAAAGTGG - Intergenic
952943379 3:38459710-38459732 CTCAGGGTGTGGTGGCCAGATGG + Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
955929193 3:64038640-64038662 CTCTAGGTCGGATGGCCAAGTGG - Intergenic
956210411 3:66796003-66796025 TTCTGCGTCAGGTGCCCAAATGG - Intergenic
961630769 3:128296821-128296843 CTCTGCGTGTGTTGGCCAGAAGG + Intronic
966473383 3:180317815-180317837 TTATAGGACTGGTGGCCAAAGGG - Intergenic
970379482 4:15492698-15492720 CACTGGGTCTGGTGGTCCAGGGG + Intronic
970469462 4:16362237-16362259 TTATGGGTCTGGTGGCCAGTAGG + Intergenic
975425868 4:74227007-74227029 CACTGGGGCTGGTGGACAAATGG - Intronic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985662574 5:1164439-1164461 GTCTGGTCCTGGTGGCCCAAGGG - Intergenic
987520407 5:18975082-18975104 CTCTGGGTTTGATGCCCCAAGGG + Intergenic
987789674 5:22548908-22548930 CCCTGGATTTGGTGGTCAAATGG - Intronic
988340167 5:29960506-29960528 CTGTGCTTCTGGTGGCCACAGGG + Intergenic
989519950 5:42389867-42389889 CTTTGGGTCTGATTGACAAAAGG - Intergenic
992434540 5:76742675-76742697 CTCTGGGTCTGGCTGAAAAATGG + Intergenic
995340881 5:111057833-111057855 GTGTGGGTATGGTGGACAAAGGG + Intergenic
996301245 5:121988736-121988758 CTCTGAGTCTGTGGGCCACAAGG - Intronic
997425361 5:133799224-133799246 CTCTGGGCCTGGTGCCCACGGGG - Intergenic
999317507 5:150593847-150593869 GTCTGGGTTTGGTGGGTAAATGG + Intergenic
1002067784 5:176660874-176660896 CTCTGGGTGAGGTGGTCATATGG + Intergenic
1003272249 6:4617580-4617602 CTCTGATTCTGGAGGTCAAATGG - Intergenic
1003664761 6:8100793-8100815 CTCTGGGGCTGGTGGCGCCAGGG - Intronic
1006297192 6:33174953-33174975 GTCGGGGTGTGGTGGGCAAAGGG - Intronic
1006347219 6:33492406-33492428 TTGTGGGTCTGGTGGCCACAGGG - Intergenic
1006474221 6:34244574-34244596 CCCTGGGCCTGGGGGCCAAGGGG + Intronic
1006728493 6:36217375-36217397 CTCAGGGTGTGGTTGACAAAGGG + Intronic
1007168747 6:39847476-39847498 GTCTGGGGCTCCTGGCCAAAGGG - Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1014640930 6:123909486-123909508 CTCTGTGTCTGCTTGCCACATGG + Intronic
1016985008 6:149888538-149888560 ATCTGTGTCTGGTGGCAAAATGG - Exonic
1019423561 7:962902-962924 CTGTGGCTCTGCTGCCCAAAGGG + Intronic
1020212070 7:6165069-6165091 CTCTGGGGCTGGTGGGAAAGGGG - Intronic
1021095125 7:16527075-16527097 CCCTGGGGCAGGGGGCCAAAGGG - Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023286843 7:38629988-38630010 CTCTGGGCCTGGGGACAAAAGGG + Intronic
1023817194 7:43960144-43960166 ACCTGGGACTGGTGGCCAAACGG + Intergenic
1024261327 7:47576265-47576287 CACTGGGCCTGGAGCCCAAAAGG + Intronic
1025211608 7:57022338-57022360 CACTGGGGCTGGGGGCCACATGG - Intergenic
1025660348 7:63554489-63554511 CACTGGGGCTGGGGGCCACATGG + Intergenic
1027446184 7:78275387-78275409 ATCTGGGTCTGCTGGCAAGATGG - Intronic
1029340442 7:99939487-99939509 TTATGGGTCTAGTGGCCAAAGGG + Intergenic
1029674825 7:102061338-102061360 CACTGGGGCTGGGGGCCACATGG - Intronic
1029964058 7:104720063-104720085 CTCTGGCTCTATTAGCCAAAAGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1036785466 8:11683110-11683132 CTCTTGGTGTGGTGGCCACTGGG + Intronic
1041179415 8:55232156-55232178 CCCTGGCTCTTGTGGCCAAGGGG + Intronic
1048733558 8:137471804-137471826 CTCAGGGACTGGTGGCCTAAAGG - Intergenic
1049311158 8:141934649-141934671 CTCTGGGGCTGCTGGGCCAATGG + Intergenic
1052984769 9:34478862-34478884 CTCTGGGTCTGGTCTACAGAAGG - Intronic
1059773368 9:117448997-117449019 CTCTGGGCCTGTTGCCCAAGTGG + Intergenic
1060987539 9:127828414-127828436 CCCTGGGGCCGGTGGCCAGAGGG - Intronic
1061221916 9:129257147-129257169 CTCTGAGCCTGGAGGCCAGAAGG - Intergenic
1061301672 9:129709247-129709269 TTGTGGGTCTGGTGGCCCCATGG + Intronic
1061813974 9:133182177-133182199 CTGGGGGCCTGGTGGCCAGATGG + Intergenic
1061919050 9:133772197-133772219 GTCTGGGGCTGGTGGCCCGAAGG - Intronic
1062149827 9:135012227-135012249 CTTTGGGTCTGGGAGTCAAAGGG - Intergenic
1062321416 9:135992339-135992361 CTCTGGGTAGGGTGGCCAGAGGG - Intergenic
1062407630 9:136404330-136404352 CTCTGGGACTGGGGGCCTAATGG + Intronic
1185891069 X:3822481-3822503 CTCAGGGTATGGTGGCCAATGGG + Intronic
1185896173 X:3860897-3860919 CTCAGGGTATGGTGGCCAATGGG + Intergenic
1185901292 X:3899323-3899345 CTCAGGGTATGGTGGCCAATGGG + Intergenic
1185906401 X:3937755-3937777 CTCAGGGCATGGTGGCCAATGGG + Intergenic
1187213823 X:17255168-17255190 CTCTGGCTCTGGCTACCAAAGGG - Intergenic
1190227923 X:48560270-48560292 CGCTGGTTTTGGTGGCCACAGGG + Exonic
1190363053 X:49667025-49667047 CTGTGGGACTGGTGGCAGAATGG + Intergenic
1191716177 X:64195210-64195232 CCCTGGGTCTGGTGGGAATAGGG + Intronic
1191859320 X:65653083-65653105 CTTTGGGACTGGGGGCCAAGAGG - Intronic
1192886232 X:75337460-75337482 CTCTGGGTCTAGTTGCCCAGTGG + Intergenic
1193305834 X:79949999-79950021 CTGTGGTTCTGGTGGCCATCAGG + Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1197892134 X:131278544-131278566 CTCTGGGTCAGGGCGCCAAGGGG + Exonic
1198313092 X:135438766-135438788 CTCTGGGTGGGGTGTCCAAGAGG - Intergenic
1199170244 X:144726727-144726749 CTCTGGGTCTAGCTGCCCAATGG - Intergenic
1199844226 X:151679095-151679117 CTGTGGGTCTGGGGGCACAAGGG + Intergenic
1200303918 X:155006330-155006352 CTCTGGTTCTGGTGGCTGGAGGG - Intronic
1200317468 X:155148576-155148598 CTCTGGTTCTGGTGGCTGGAGGG + Intergenic
1200878063 Y:8180457-8180479 TTCTGGCTCTGGTTGGCAAAGGG + Intergenic