ID: 1142629776

View in Genome Browser
Species Human (GRCh38)
Location 17:1217257-1217279
Sequence ATCCAATTACAGACGCGTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 24}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142629776_1142629777 -1 Left 1142629776 17:1217257-1217279 CCGTGACGCGTCTGTAATTGGAT 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1142629777 17:1217279-1217301 TGCTTCGCTGTTCCAGCTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 136
1142629776_1142629779 16 Left 1142629776 17:1217257-1217279 CCGTGACGCGTCTGTAATTGGAT 0: 1
1: 0
2: 0
3: 2
4: 24
Right 1142629779 17:1217296-1217318 TCTTGGATTATTCAAATTACAGG 0: 1
1: 0
2: 0
3: 18
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142629776 Original CRISPR ATCCAATTACAGACGCGTCA CGG (reversed) Intronic
900800482 1:4734125-4734147 ATCCAAATACAGACCTGCCAGGG + Intronic
902991364 1:20189557-20189579 ATCCAAATACAGAGGCCCCAGGG + Intronic
904394334 1:30208353-30208375 ATCCAATTACAGAATCTCCAAGG - Intergenic
911657228 1:100458664-100458686 ATCCAATTACAGTGACGTCTTGG + Intronic
918137355 1:181686238-181686260 ATCCAATTACAGAGGCTTGGAGG + Intronic
919458119 1:197844262-197844284 AGCCAATTTCAGAGGCGCCATGG + Intergenic
921512980 1:216054796-216054818 GTCCAATTACAGACAGGCCAAGG - Intronic
1093293329 12:17356495-17356517 ATCTAATTACAGTCACGGCATGG + Intergenic
1142629776 17:1217257-1217279 ATCCAATTACAGACGCGTCACGG - Intronic
1158889394 18:61858998-61859020 ATCCAATTACAGGAGGGTGAAGG + Intronic
1170693605 20:18637336-18637358 ACGCAATTACAGATGTGTCAGGG + Intronic
1174034717 20:47661636-47661658 ATACAGTTCCAGACGAGTCATGG - Intronic
1185020679 22:48372946-48372968 TTCCAATTACAGATGCGGCCTGG - Intergenic
949712942 3:6892703-6892725 ACCCAATTACAGACACCTGAGGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
974753826 4:66177444-66177466 ATCCAATAAAAGATGCTTCAGGG - Intergenic
989104176 5:37845524-37845546 AGCCAATTACAGAAGCATCATGG - Intergenic
997826072 5:137107992-137108014 CTCCAACTACACATGCGTCATGG + Intronic
1009981226 6:70728168-70728190 ATCCAATTACAAAAGCCCCATGG - Intronic
1016634149 6:146267941-146267963 ATCCAATTACTGACTTGTGATGG - Intronic
1023345795 7:39269898-39269920 ATCCCATTCCAGACTCATCAAGG + Intronic
1025141454 7:56470256-56470278 ATACAATTACAGACGTGACAAGG + Intergenic
1042448085 8:68912540-68912562 ATCCAATTACAGAATCTACAGGG + Intergenic
1043379752 8:79689825-79689847 ATCCAAGTGCAGATGCCTCATGG + Intergenic
1045586327 8:103541133-103541155 ATCCAATTACAGGAAGGTCAGGG + Intronic
1053099923 9:35363191-35363213 ATCCATTGACAGAGCCGTCACGG - Intronic
1196053943 X:111334955-111334977 ATCCAATGACAGAGGCTACATGG + Intronic