ID: 1142631484

View in Genome Browser
Species Human (GRCh38)
Location 17:1229167-1229189
Sequence GCTCCCGGCACGGACGAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142631484_1142631504 15 Left 1142631484 17:1229167-1229189 CCCCCCTCGTCCGTGCCGGGAGC No data
Right 1142631504 17:1229205-1229227 GAGGGGCGCGTCGTCCTCCCGGG No data
1142631484_1142631496 -3 Left 1142631484 17:1229167-1229189 CCCCCCTCGTCCGTGCCGGGAGC No data
Right 1142631496 17:1229187-1229209 AGCCGCCTGGGGGTCCCCGAGGG No data
1142631484_1142631495 -4 Left 1142631484 17:1229167-1229189 CCCCCCTCGTCCGTGCCGGGAGC No data
Right 1142631495 17:1229186-1229208 GAGCCGCCTGGGGGTCCCCGAGG No data
1142631484_1142631503 14 Left 1142631484 17:1229167-1229189 CCCCCCTCGTCCGTGCCGGGAGC No data
Right 1142631503 17:1229204-1229226 CGAGGGGCGCGTCGTCCTCCCGG No data
1142631484_1142631497 -2 Left 1142631484 17:1229167-1229189 CCCCCCTCGTCCGTGCCGGGAGC No data
Right 1142631497 17:1229188-1229210 GCCGCCTGGGGGTCCCCGAGGGG No data
1142631484_1142631505 20 Left 1142631484 17:1229167-1229189 CCCCCCTCGTCCGTGCCGGGAGC No data
Right 1142631505 17:1229210-1229232 GCGCGTCGTCCTCCCGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142631484 Original CRISPR GCTCCCGGCACGGACGAGGG GGG (reversed) Intergenic
No off target data available for this crispr