ID: 1142631692

View in Genome Browser
Species Human (GRCh38)
Location 17:1229801-1229823
Sequence GGGGCGGGTTCTCATCCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142631692_1142631711 18 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631711 17:1229842-1229864 TCGGGCCGCGGAGCCGCCGGGGG No data
1142631692_1142631712 21 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631712 17:1229845-1229867 GGCCGCGGAGCCGCCGGGGGAGG No data
1142631692_1142631702 -1 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631702 17:1229823-1229845 CGGGCATCCCACAGCCAGCTCGG No data
1142631692_1142631709 16 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631709 17:1229840-1229862 GCTCGGGCCGCGGAGCCGCCGGG No data
1142631692_1142631710 17 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631710 17:1229841-1229863 CTCGGGCCGCGGAGCCGCCGGGG No data
1142631692_1142631705 6 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631705 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data
1142631692_1142631708 15 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631708 17:1229839-1229861 AGCTCGGGCCGCGGAGCCGCCGG No data
1142631692_1142631715 25 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631715 17:1229849-1229871 GCGGAGCCGCCGGGGGAGGGCGG No data
1142631692_1142631713 22 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631692_1142631716 26 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631716 17:1229850-1229872 CGGAGCCGCCGGGGGAGGGCGGG 0: 1
1: 0
2: 1
3: 61
4: 546
1142631692_1142631703 0 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631703 17:1229824-1229846 GGGCATCCCACAGCCAGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142631692 Original CRISPR GGGGCGGGTTCTCATCCCCG GGG (reversed) Intergenic