ID: 1142631694

View in Genome Browser
Species Human (GRCh38)
Location 17:1229803-1229825
Sequence CCGGGGCGGGTTCTCATCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142631694_1142631709 14 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631709 17:1229840-1229862 GCTCGGGCCGCGGAGCCGCCGGG No data
1142631694_1142631716 24 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631716 17:1229850-1229872 CGGAGCCGCCGGGGGAGGGCGGG No data
1142631694_1142631702 -3 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631702 17:1229823-1229845 CGGGCATCCCACAGCCAGCTCGG No data
1142631694_1142631708 13 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631708 17:1229839-1229861 AGCTCGGGCCGCGGAGCCGCCGG No data
1142631694_1142631705 4 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631705 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data
1142631694_1142631711 16 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631711 17:1229842-1229864 TCGGGCCGCGGAGCCGCCGGGGG No data
1142631694_1142631703 -2 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631703 17:1229824-1229846 GGGCATCCCACAGCCAGCTCGGG No data
1142631694_1142631715 23 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631715 17:1229849-1229871 GCGGAGCCGCCGGGGGAGGGCGG No data
1142631694_1142631713 20 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631694_1142631710 15 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631710 17:1229841-1229863 CTCGGGCCGCGGAGCCGCCGGGG No data
1142631694_1142631712 19 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631712 17:1229845-1229867 GGCCGCGGAGCCGCCGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142631694 Original CRISPR CCGGGGCGGGTTCTCATCCC CGG (reversed) Intergenic