ID: 1142631697

View in Genome Browser
Species Human (GRCh38)
Location 17:1229816-1229838
Sequence GGCTGTGGGATGCCCGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142631697_1142631712 6 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631712 17:1229845-1229867 GGCCGCGGAGCCGCCGGGGGAGG No data
1142631697_1142631715 10 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631715 17:1229849-1229871 GCGGAGCCGCCGGGGGAGGGCGG No data
1142631697_1142631710 2 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631710 17:1229841-1229863 CTCGGGCCGCGGAGCCGCCGGGG No data
1142631697_1142631721 21 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631721 17:1229860-1229882 GGGGGAGGGCGGGAGCTGCGGGG No data
1142631697_1142631719 19 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631719 17:1229858-1229880 CCGGGGGAGGGCGGGAGCTGCGG No data
1142631697_1142631716 11 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631716 17:1229850-1229872 CGGAGCCGCCGGGGGAGGGCGGG No data
1142631697_1142631708 0 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631708 17:1229839-1229861 AGCTCGGGCCGCGGAGCCGCCGG No data
1142631697_1142631720 20 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631720 17:1229859-1229881 CGGGGGAGGGCGGGAGCTGCGGG No data
1142631697_1142631711 3 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631711 17:1229842-1229864 TCGGGCCGCGGAGCCGCCGGGGG No data
1142631697_1142631705 -9 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631705 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data
1142631697_1142631709 1 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631709 17:1229840-1229862 GCTCGGGCCGCGGAGCCGCCGGG No data
1142631697_1142631713 7 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631697_1142631722 26 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631722 17:1229865-1229887 AGGGCGGGAGCTGCGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142631697 Original CRISPR GGCTGTGGGATGCCCGGGGC GGG (reversed) Intergenic