ID: 1142631699

View in Genome Browser
Species Human (GRCh38)
Location 17:1229820-1229842
Sequence AGCTGGCTGTGGGATGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142631699_1142631713 3 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631699_1142631721 17 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631721 17:1229860-1229882 GGGGGAGGGCGGGAGCTGCGGGG No data
1142631699_1142631720 16 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631720 17:1229859-1229881 CGGGGGAGGGCGGGAGCTGCGGG No data
1142631699_1142631708 -4 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631708 17:1229839-1229861 AGCTCGGGCCGCGGAGCCGCCGG No data
1142631699_1142631709 -3 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631709 17:1229840-1229862 GCTCGGGCCGCGGAGCCGCCGGG No data
1142631699_1142631712 2 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631712 17:1229845-1229867 GGCCGCGGAGCCGCCGGGGGAGG No data
1142631699_1142631715 6 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631715 17:1229849-1229871 GCGGAGCCGCCGGGGGAGGGCGG No data
1142631699_1142631710 -2 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631710 17:1229841-1229863 CTCGGGCCGCGGAGCCGCCGGGG No data
1142631699_1142631711 -1 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631711 17:1229842-1229864 TCGGGCCGCGGAGCCGCCGGGGG No data
1142631699_1142631716 7 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631716 17:1229850-1229872 CGGAGCCGCCGGGGGAGGGCGGG No data
1142631699_1142631719 15 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631719 17:1229858-1229880 CCGGGGGAGGGCGGGAGCTGCGG No data
1142631699_1142631722 22 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631722 17:1229865-1229887 AGGGCGGGAGCTGCGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142631699 Original CRISPR AGCTGGCTGTGGGATGCCCG GGG (reversed) Intergenic