ID: 1142631703

View in Genome Browser
Species Human (GRCh38)
Location 17:1229824-1229846
Sequence GGGCATCCCACAGCCAGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142631688_1142631703 20 Left 1142631688 17:1229781-1229803 CCTCGCGGCGGGGGCGGGCGCCC No data
Right 1142631703 17:1229824-1229846 GGGCATCCCACAGCCAGCTCGGG No data
1142631694_1142631703 -2 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631703 17:1229824-1229846 GGGCATCCCACAGCCAGCTCGGG No data
1142631693_1142631703 -1 Left 1142631693 17:1229802-1229824 CCCGGGGATGAGAACCCGCCCCG No data
Right 1142631703 17:1229824-1229846 GGGCATCCCACAGCCAGCTCGGG No data
1142631692_1142631703 0 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631703 17:1229824-1229846 GGGCATCCCACAGCCAGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142631703 Original CRISPR GGGCATCCCACAGCCAGCTC GGG Intergenic
No off target data available for this crispr