ID: 1142631705

View in Genome Browser
Species Human (GRCh38)
Location 17:1229830-1229852
Sequence CCCACAGCCAGCTCGGGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142631698_1142631705 -10 Left 1142631698 17:1229817-1229839 CCGCCCCGGGCATCCCACAGCCA No data
Right 1142631705 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data
1142631697_1142631705 -9 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631705 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data
1142631693_1142631705 5 Left 1142631693 17:1229802-1229824 CCCGGGGATGAGAACCCGCCCCG No data
Right 1142631705 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data
1142631692_1142631705 6 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631705 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data
1142631694_1142631705 4 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631705 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data
1142631688_1142631705 26 Left 1142631688 17:1229781-1229803 CCTCGCGGCGGGGGCGGGCGCCC No data
Right 1142631705 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142631705 Original CRISPR CCCACAGCCAGCTCGGGCCG CGG Intergenic