ID: 1142631713

View in Genome Browser
Species Human (GRCh38)
Location 17:1229846-1229868
Sequence GCCGCGGAGCCGCCGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142631698_1142631713 6 Left 1142631698 17:1229817-1229839 CCGCCCCGGGCATCCCACAGCCA No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631699_1142631713 3 Left 1142631699 17:1229820-1229842 CCCCGGGCATCCCACAGCCAGCT No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631706_1142631713 -8 Left 1142631706 17:1229831-1229853 CCACAGCCAGCTCGGGCCGCGGA No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631700_1142631713 2 Left 1142631700 17:1229821-1229843 CCCGGGCATCCCACAGCCAGCTC No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631692_1142631713 22 Left 1142631692 17:1229801-1229823 CCCCGGGGATGAGAACCCGCCCC No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631701_1142631713 1 Left 1142631701 17:1229822-1229844 CCGGGCATCCCACAGCCAGCTCG No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631697_1142631713 7 Left 1142631697 17:1229816-1229838 CCCGCCCCGGGCATCCCACAGCC No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631704_1142631713 -7 Left 1142631704 17:1229830-1229852 CCCACAGCCAGCTCGGGCCGCGG No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631694_1142631713 20 Left 1142631694 17:1229803-1229825 CCGGGGATGAGAACCCGCCCCGG No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data
1142631693_1142631713 21 Left 1142631693 17:1229802-1229824 CCCGGGGATGAGAACCCGCCCCG No data
Right 1142631713 17:1229846-1229868 GCCGCGGAGCCGCCGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142631713 Original CRISPR GCCGCGGAGCCGCCGGGGGA GGG Intergenic