ID: 1142632798

View in Genome Browser
Species Human (GRCh38)
Location 17:1236322-1236344
Sequence ACAAGATTCTAGGAAGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142632798_1142632803 -3 Left 1142632798 17:1236322-1236344 CCGGCCCCTTCCTAGAATCTTGT No data
Right 1142632803 17:1236342-1236364 TGTATGAAAGAATGTAGTCTTGG No data
1142632798_1142632804 3 Left 1142632798 17:1236322-1236344 CCGGCCCCTTCCTAGAATCTTGT No data
Right 1142632804 17:1236348-1236370 AAAGAATGTAGTCTTGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142632798 Original CRISPR ACAAGATTCTAGGAAGGGGC CGG (reversed) Intergenic
No off target data available for this crispr