ID: 1142637288

View in Genome Browser
Species Human (GRCh38)
Location 17:1265864-1265886
Sequence TGTAGTCCCAGCTACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1097396
Summary {0: 41507, 1: 154089, 2: 219927, 3: 224998, 4: 456875}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637288_1142637291 -2 Left 1142637288 17:1265864-1265886 CCTCCCAAGTAGCTGGGACTACA 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
Right 1142637291 17:1265885-1265907 CAGACGCCTGCCACAATGCCCGG No data
1142637288_1142637297 28 Left 1142637288 17:1265864-1265886 CCTCCCAAGTAGCTGGGACTACA 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data
1142637288_1142637296 27 Left 1142637288 17:1265864-1265886 CCTCCCAAGTAGCTGGGACTACA 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
Right 1142637296 17:1265914-1265936 TTTTGTATGTTCAGTAAAGACGG No data
1142637288_1142637298 29 Left 1142637288 17:1265864-1265886 CCTCCCAAGTAGCTGGGACTACA 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
Right 1142637298 17:1265916-1265938 TTGTATGTTCAGTAAAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637288 Original CRISPR TGTAGTCCCAGCTACTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr