ID: 1142637289

View in Genome Browser
Species Human (GRCh38)
Location 17:1265867-1265889
Sequence GTCTGTAGTCCCAGCTACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 699764
Summary {0: 1063, 1: 36894, 2: 169605, 3: 264271, 4: 227931}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637289_1142637291 -5 Left 1142637289 17:1265867-1265889 CCCAAGTAGCTGGGACTACAGAC 0: 1063
1: 36894
2: 169605
3: 264271
4: 227931
Right 1142637291 17:1265885-1265907 CAGACGCCTGCCACAATGCCCGG No data
1142637289_1142637296 24 Left 1142637289 17:1265867-1265889 CCCAAGTAGCTGGGACTACAGAC 0: 1063
1: 36894
2: 169605
3: 264271
4: 227931
Right 1142637296 17:1265914-1265936 TTTTGTATGTTCAGTAAAGACGG No data
1142637289_1142637297 25 Left 1142637289 17:1265867-1265889 CCCAAGTAGCTGGGACTACAGAC 0: 1063
1: 36894
2: 169605
3: 264271
4: 227931
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data
1142637289_1142637298 26 Left 1142637289 17:1265867-1265889 CCCAAGTAGCTGGGACTACAGAC 0: 1063
1: 36894
2: 169605
3: 264271
4: 227931
Right 1142637298 17:1265916-1265938 TTGTATGTTCAGTAAAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637289 Original CRISPR GTCTGTAGTCCCAGCTACTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr