ID: 1142637290

View in Genome Browser
Species Human (GRCh38)
Location 17:1265868-1265890
Sequence CGTCTGTAGTCCCAGCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 478448
Summary {0: 914, 1: 47477, 2: 116763, 3: 180045, 4: 133249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637290_1142637296 23 Left 1142637290 17:1265868-1265890 CCAAGTAGCTGGGACTACAGACG 0: 914
1: 47477
2: 116763
3: 180045
4: 133249
Right 1142637296 17:1265914-1265936 TTTTGTATGTTCAGTAAAGACGG No data
1142637290_1142637291 -6 Left 1142637290 17:1265868-1265890 CCAAGTAGCTGGGACTACAGACG 0: 914
1: 47477
2: 116763
3: 180045
4: 133249
Right 1142637291 17:1265885-1265907 CAGACGCCTGCCACAATGCCCGG No data
1142637290_1142637297 24 Left 1142637290 17:1265868-1265890 CCAAGTAGCTGGGACTACAGACG 0: 914
1: 47477
2: 116763
3: 180045
4: 133249
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data
1142637290_1142637298 25 Left 1142637290 17:1265868-1265890 CCAAGTAGCTGGGACTACAGACG 0: 914
1: 47477
2: 116763
3: 180045
4: 133249
Right 1142637298 17:1265916-1265938 TTGTATGTTCAGTAAAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637290 Original CRISPR CGTCTGTAGTCCCAGCTACT TGG (reversed) Intergenic
Too many off-targets to display for this crispr