ID: 1142637292

View in Genome Browser
Species Human (GRCh38)
Location 17:1265891-1265913
Sequence AATTAGCCGGGCATTGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212178
Summary {0: 113, 1: 8920, 2: 49144, 3: 81282, 4: 72719}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637292_1142637298 2 Left 1142637292 17:1265891-1265913 CCTGCCACAATGCCCGGCTAATT 0: 113
1: 8920
2: 49144
3: 81282
4: 72719
Right 1142637298 17:1265916-1265938 TTGTATGTTCAGTAAAGACGGGG No data
1142637292_1142637300 25 Left 1142637292 17:1265891-1265913 CCTGCCACAATGCCCGGCTAATT 0: 113
1: 8920
2: 49144
3: 81282
4: 72719
Right 1142637300 17:1265939-1265961 TTTCACCACGTTAGCCAGGATGG 0: 686
1: 22179
2: 79780
3: 158316
4: 169814
1142637292_1142637299 21 Left 1142637292 17:1265891-1265913 CCTGCCACAATGCCCGGCTAATT 0: 113
1: 8920
2: 49144
3: 81282
4: 72719
Right 1142637299 17:1265935-1265957 GGGGTTTCACCACGTTAGCCAGG 0: 609
1: 21916
2: 124832
3: 186751
4: 169515
1142637292_1142637297 1 Left 1142637292 17:1265891-1265913 CCTGCCACAATGCCCGGCTAATT 0: 113
1: 8920
2: 49144
3: 81282
4: 72719
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data
1142637292_1142637296 0 Left 1142637292 17:1265891-1265913 CCTGCCACAATGCCCGGCTAATT 0: 113
1: 8920
2: 49144
3: 81282
4: 72719
Right 1142637296 17:1265914-1265936 TTTTGTATGTTCAGTAAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637292 Original CRISPR AATTAGCCGGGCATTGTGGC AGG (reversed) Intergenic
Too many off-targets to display for this crispr