ID: 1142637293

View in Genome Browser
Species Human (GRCh38)
Location 17:1265895-1265917
Sequence AAAAAATTAGCCGGGCATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 484575
Summary {0: 202, 1: 12584, 2: 80129, 3: 181089, 4: 210571}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637293_1142637297 -3 Left 1142637293 17:1265895-1265917 CCACAATGCCCGGCTAATTTTTT 0: 202
1: 12584
2: 80129
3: 181089
4: 210571
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data
1142637293_1142637296 -4 Left 1142637293 17:1265895-1265917 CCACAATGCCCGGCTAATTTTTT 0: 202
1: 12584
2: 80129
3: 181089
4: 210571
Right 1142637296 17:1265914-1265936 TTTTGTATGTTCAGTAAAGACGG No data
1142637293_1142637298 -2 Left 1142637293 17:1265895-1265917 CCACAATGCCCGGCTAATTTTTT 0: 202
1: 12584
2: 80129
3: 181089
4: 210571
Right 1142637298 17:1265916-1265938 TTGTATGTTCAGTAAAGACGGGG No data
1142637293_1142637300 21 Left 1142637293 17:1265895-1265917 CCACAATGCCCGGCTAATTTTTT 0: 202
1: 12584
2: 80129
3: 181089
4: 210571
Right 1142637300 17:1265939-1265961 TTTCACCACGTTAGCCAGGATGG 0: 686
1: 22179
2: 79780
3: 158316
4: 169814
1142637293_1142637299 17 Left 1142637293 17:1265895-1265917 CCACAATGCCCGGCTAATTTTTT 0: 202
1: 12584
2: 80129
3: 181089
4: 210571
Right 1142637299 17:1265935-1265957 GGGGTTTCACCACGTTAGCCAGG 0: 609
1: 21916
2: 124832
3: 186751
4: 169515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637293 Original CRISPR AAAAAATTAGCCGGGCATTG TGG (reversed) Intergenic
Too many off-targets to display for this crispr