ID: 1142637294

View in Genome Browser
Species Human (GRCh38)
Location 17:1265903-1265925
Sequence GAACATACAAAAAATTAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160519
Summary {0: 7, 1: 1639, 2: 57967, 3: 53901, 4: 47005}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637294_1142637298 -10 Left 1142637294 17:1265903-1265925 CCCGGCTAATTTTTTGTATGTTC 0: 7
1: 1639
2: 57967
3: 53901
4: 47005
Right 1142637298 17:1265916-1265938 TTGTATGTTCAGTAAAGACGGGG No data
1142637294_1142637300 13 Left 1142637294 17:1265903-1265925 CCCGGCTAATTTTTTGTATGTTC 0: 7
1: 1639
2: 57967
3: 53901
4: 47005
Right 1142637300 17:1265939-1265961 TTTCACCACGTTAGCCAGGATGG 0: 686
1: 22179
2: 79780
3: 158316
4: 169814
1142637294_1142637299 9 Left 1142637294 17:1265903-1265925 CCCGGCTAATTTTTTGTATGTTC 0: 7
1: 1639
2: 57967
3: 53901
4: 47005
Right 1142637299 17:1265935-1265957 GGGGTTTCACCACGTTAGCCAGG 0: 609
1: 21916
2: 124832
3: 186751
4: 169515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637294 Original CRISPR GAACATACAAAAAATTAGCC GGG (reversed) Intergenic
Too many off-targets to display for this crispr