ID: 1142637297

View in Genome Browser
Species Human (GRCh38)
Location 17:1265915-1265937
Sequence TTTGTATGTTCAGTAAAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637289_1142637297 25 Left 1142637289 17:1265867-1265889 CCCAAGTAGCTGGGACTACAGAC 0: 1063
1: 36894
2: 169605
3: 264271
4: 227931
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data
1142637290_1142637297 24 Left 1142637290 17:1265868-1265890 CCAAGTAGCTGGGACTACAGACG 0: 914
1: 47477
2: 116763
3: 180045
4: 133249
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data
1142637293_1142637297 -3 Left 1142637293 17:1265895-1265917 CCACAATGCCCGGCTAATTTTTT 0: 202
1: 12584
2: 80129
3: 181089
4: 210571
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data
1142637292_1142637297 1 Left 1142637292 17:1265891-1265913 CCTGCCACAATGCCCGGCTAATT 0: 113
1: 8920
2: 49144
3: 81282
4: 72719
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data
1142637288_1142637297 28 Left 1142637288 17:1265864-1265886 CCTCCCAAGTAGCTGGGACTACA 0: 41507
1: 154089
2: 219927
3: 224998
4: 456875
Right 1142637297 17:1265915-1265937 TTTGTATGTTCAGTAAAGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637297 Original CRISPR TTTGTATGTTCAGTAAAGAC GGG Intergenic
No off target data available for this crispr