ID: 1142637299

View in Genome Browser
Species Human (GRCh38)
Location 17:1265935-1265957
Sequence GGGGTTTCACCACGTTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 503623
Summary {0: 609, 1: 21916, 2: 124832, 3: 186751, 4: 169515}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637292_1142637299 21 Left 1142637292 17:1265891-1265913 CCTGCCACAATGCCCGGCTAATT 0: 113
1: 8920
2: 49144
3: 81282
4: 72719
Right 1142637299 17:1265935-1265957 GGGGTTTCACCACGTTAGCCAGG 0: 609
1: 21916
2: 124832
3: 186751
4: 169515
1142637294_1142637299 9 Left 1142637294 17:1265903-1265925 CCCGGCTAATTTTTTGTATGTTC 0: 7
1: 1639
2: 57967
3: 53901
4: 47005
Right 1142637299 17:1265935-1265957 GGGGTTTCACCACGTTAGCCAGG 0: 609
1: 21916
2: 124832
3: 186751
4: 169515
1142637293_1142637299 17 Left 1142637293 17:1265895-1265917 CCACAATGCCCGGCTAATTTTTT 0: 202
1: 12584
2: 80129
3: 181089
4: 210571
Right 1142637299 17:1265935-1265957 GGGGTTTCACCACGTTAGCCAGG 0: 609
1: 21916
2: 124832
3: 186751
4: 169515
1142637295_1142637299 8 Left 1142637295 17:1265904-1265926 CCGGCTAATTTTTTGTATGTTCA 0: 6
1: 1495
2: 48870
3: 33534
4: 18038
Right 1142637299 17:1265935-1265957 GGGGTTTCACCACGTTAGCCAGG 0: 609
1: 21916
2: 124832
3: 186751
4: 169515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637299 Original CRISPR GGGGTTTCACCACGTTAGCC AGG Intergenic
Too many off-targets to display for this crispr