ID: 1142637300

View in Genome Browser
Species Human (GRCh38)
Location 17:1265939-1265961
Sequence TTTCACCACGTTAGCCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430775
Summary {0: 686, 1: 22179, 2: 79780, 3: 158316, 4: 169814}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637295_1142637300 12 Left 1142637295 17:1265904-1265926 CCGGCTAATTTTTTGTATGTTCA 0: 6
1: 1495
2: 48870
3: 33534
4: 18038
Right 1142637300 17:1265939-1265961 TTTCACCACGTTAGCCAGGATGG 0: 686
1: 22179
2: 79780
3: 158316
4: 169814
1142637294_1142637300 13 Left 1142637294 17:1265903-1265925 CCCGGCTAATTTTTTGTATGTTC 0: 7
1: 1639
2: 57967
3: 53901
4: 47005
Right 1142637300 17:1265939-1265961 TTTCACCACGTTAGCCAGGATGG 0: 686
1: 22179
2: 79780
3: 158316
4: 169814
1142637292_1142637300 25 Left 1142637292 17:1265891-1265913 CCTGCCACAATGCCCGGCTAATT 0: 113
1: 8920
2: 49144
3: 81282
4: 72719
Right 1142637300 17:1265939-1265961 TTTCACCACGTTAGCCAGGATGG 0: 686
1: 22179
2: 79780
3: 158316
4: 169814
1142637293_1142637300 21 Left 1142637293 17:1265895-1265917 CCACAATGCCCGGCTAATTTTTT 0: 202
1: 12584
2: 80129
3: 181089
4: 210571
Right 1142637300 17:1265939-1265961 TTTCACCACGTTAGCCAGGATGG 0: 686
1: 22179
2: 79780
3: 158316
4: 169814

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637300 Original CRISPR TTTCACCACGTTAGCCAGGA TGG Intergenic
Too many off-targets to display for this crispr