ID: 1142637659

View in Genome Browser
Species Human (GRCh38)
Location 17:1268194-1268216
Sequence CCGGGACCCGCTCTCCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142637649_1142637659 5 Left 1142637649 17:1268166-1268188 CCTGGGAGAGAAGGAGGCTCAGG No data
Right 1142637659 17:1268194-1268216 CCGGGACCCGCTCTCCGGAGGGG No data
1142637646_1142637659 16 Left 1142637646 17:1268155-1268177 CCAGGGTCTCGCCTGGGAGAGAA No data
Right 1142637659 17:1268194-1268216 CCGGGACCCGCTCTCCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142637659 Original CRISPR CCGGGACCCGCTCTCCGGAG GGG Intergenic
No off target data available for this crispr