ID: 1142644040

View in Genome Browser
Species Human (GRCh38)
Location 17:1300713-1300735
Sequence TGGACACCAGGGGACCTGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142644032_1142644040 -2 Left 1142644032 17:1300692-1300714 CCCTGGAGGAGAAAGCCATTCTG 0: 1
1: 0
2: 2
3: 33
4: 221
Right 1142644040 17:1300713-1300735 TGGACACCAGGGGACCTGGACGG 0: 1
1: 0
2: 0
3: 27
4: 270
1142644033_1142644040 -3 Left 1142644033 17:1300693-1300715 CCTGGAGGAGAAAGCCATTCTGG 0: 1
1: 0
2: 1
3: 33
4: 257
Right 1142644040 17:1300713-1300735 TGGACACCAGGGGACCTGGACGG 0: 1
1: 0
2: 0
3: 27
4: 270
1142644025_1142644040 30 Left 1142644025 17:1300660-1300682 CCGCAGAGCACAGAGCAGGAGAA 0: 1
1: 0
2: 8
3: 60
4: 487
Right 1142644040 17:1300713-1300735 TGGACACCAGGGGACCTGGACGG 0: 1
1: 0
2: 0
3: 27
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142644040 Original CRISPR TGGACACCAGGGGACCTGGA CGG Exonic