ID: 1142644450

View in Genome Browser
Species Human (GRCh38)
Location 17:1302898-1302920
Sequence GCCGCGTCCTGGGGCTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142644442_1142644450 21 Left 1142644442 17:1302854-1302876 CCATGGGCTGTGGGAGGCCCGAC No data
Right 1142644450 17:1302898-1302920 GCCGCGTCCTGGGGCTCAGCAGG No data
1142644445_1142644450 3 Left 1142644445 17:1302872-1302894 CCGACAGAGAGCTGGACACACAG No data
Right 1142644450 17:1302898-1302920 GCCGCGTCCTGGGGCTCAGCAGG No data
1142644441_1142644450 22 Left 1142644441 17:1302853-1302875 CCCATGGGCTGTGGGAGGCCCGA No data
Right 1142644450 17:1302898-1302920 GCCGCGTCCTGGGGCTCAGCAGG No data
1142644444_1142644450 4 Left 1142644444 17:1302871-1302893 CCCGACAGAGAGCTGGACACACA No data
Right 1142644450 17:1302898-1302920 GCCGCGTCCTGGGGCTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142644450 Original CRISPR GCCGCGTCCTGGGGCTCAGC AGG Intergenic
No off target data available for this crispr