ID: 1142649959

View in Genome Browser
Species Human (GRCh38)
Location 17:1342440-1342462
Sequence ATGAACTTCCATCACTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142649959_1142649967 30 Left 1142649959 17:1342440-1342462 CCCTTTCAGTGATGGAAGTTCAT No data
Right 1142649967 17:1342493-1342515 TTTGCAGACGTGCTGTTCTGAGG No data
1142649959_1142649961 -6 Left 1142649959 17:1342440-1342462 CCCTTTCAGTGATGGAAGTTCAT No data
Right 1142649961 17:1342457-1342479 GTTCATCCCCATCTTCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142649959 Original CRISPR ATGAACTTCCATCACTGAAA GGG (reversed) Intergenic
No off target data available for this crispr