ID: 1142649961

View in Genome Browser
Species Human (GRCh38)
Location 17:1342457-1342479
Sequence GTTCATCCCCATCTTCCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142649956_1142649961 2 Left 1142649956 17:1342432-1342454 CCAGTTTCCCCTTTCAGTGATGG No data
Right 1142649961 17:1342457-1342479 GTTCATCCCCATCTTCCTATAGG No data
1142649953_1142649961 14 Left 1142649953 17:1342420-1342442 CCATTTATCCCACCAGTTTCCCC No data
Right 1142649961 17:1342457-1342479 GTTCATCCCCATCTTCCTATAGG No data
1142649960_1142649961 -7 Left 1142649960 17:1342441-1342463 CCTTTCAGTGATGGAAGTTCATC No data
Right 1142649961 17:1342457-1342479 GTTCATCCCCATCTTCCTATAGG No data
1142649952_1142649961 27 Left 1142649952 17:1342407-1342429 CCAATTAATGTCTCCATTTATCC No data
Right 1142649961 17:1342457-1342479 GTTCATCCCCATCTTCCTATAGG No data
1142649954_1142649961 6 Left 1142649954 17:1342428-1342450 CCCACCAGTTTCCCCTTTCAGTG No data
Right 1142649961 17:1342457-1342479 GTTCATCCCCATCTTCCTATAGG No data
1142649958_1142649961 -5 Left 1142649958 17:1342439-1342461 CCCCTTTCAGTGATGGAAGTTCA No data
Right 1142649961 17:1342457-1342479 GTTCATCCCCATCTTCCTATAGG No data
1142649955_1142649961 5 Left 1142649955 17:1342429-1342451 CCACCAGTTTCCCCTTTCAGTGA No data
Right 1142649961 17:1342457-1342479 GTTCATCCCCATCTTCCTATAGG No data
1142649959_1142649961 -6 Left 1142649959 17:1342440-1342462 CCCTTTCAGTGATGGAAGTTCAT No data
Right 1142649961 17:1342457-1342479 GTTCATCCCCATCTTCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142649961 Original CRISPR GTTCATCCCCATCTTCCTAT AGG Intergenic
No off target data available for this crispr