ID: 1142649967

View in Genome Browser
Species Human (GRCh38)
Location 17:1342493-1342515
Sequence TTTGCAGACGTGCTGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142649959_1142649967 30 Left 1142649959 17:1342440-1342462 CCCTTTCAGTGATGGAAGTTCAT No data
Right 1142649967 17:1342493-1342515 TTTGCAGACGTGCTGTTCTGAGG No data
1142649963_1142649967 6 Left 1142649963 17:1342464-1342486 CCCATCTTCCTATAGGACCGAAA No data
Right 1142649967 17:1342493-1342515 TTTGCAGACGTGCTGTTCTGAGG No data
1142649965_1142649967 -2 Left 1142649965 17:1342472-1342494 CCTATAGGACCGAAATTTAACTT No data
Right 1142649967 17:1342493-1342515 TTTGCAGACGTGCTGTTCTGAGG No data
1142649964_1142649967 5 Left 1142649964 17:1342465-1342487 CCATCTTCCTATAGGACCGAAAT No data
Right 1142649967 17:1342493-1342515 TTTGCAGACGTGCTGTTCTGAGG No data
1142649962_1142649967 7 Left 1142649962 17:1342463-1342485 CCCCATCTTCCTATAGGACCGAA No data
Right 1142649967 17:1342493-1342515 TTTGCAGACGTGCTGTTCTGAGG No data
1142649960_1142649967 29 Left 1142649960 17:1342441-1342463 CCTTTCAGTGATGGAAGTTCATC No data
Right 1142649967 17:1342493-1342515 TTTGCAGACGTGCTGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142649967 Original CRISPR TTTGCAGACGTGCTGTTCTG AGG Intergenic
No off target data available for this crispr