ID: 1142652562

View in Genome Browser
Species Human (GRCh38)
Location 17:1364822-1364844
Sequence CTGTGGATAAGGGGGGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 270}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142652552_1142652562 24 Left 1142652552 17:1364775-1364797 CCTTTTCTCTCAAAATCTTAAGT 0: 1
1: 0
2: 3
3: 36
4: 422
Right 1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG 0: 1
1: 1
2: 3
3: 32
4: 270
1142652554_1142652562 -2 Left 1142652554 17:1364801-1364823 CCGTCCTACAGGTAACTCAAACT 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG 0: 1
1: 1
2: 3
3: 32
4: 270
1142652555_1142652562 -6 Left 1142652555 17:1364805-1364827 CCTACAGGTAACTCAAACTGTGG 0: 1
1: 0
2: 3
3: 13
4: 129
Right 1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG 0: 1
1: 1
2: 3
3: 32
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142652562 Original CRISPR CTGTGGATAAGGGGGGATGA TGG Intronic
900911740 1:5601503-5601525 TCGTGGATAAGGAGGGCTGAAGG + Intergenic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
903335566 1:22622037-22622059 CTGTGGAGAGTGGGGGATGAGGG + Intergenic
903342250 1:22661800-22661822 CTGAGGATCAGAAGGGATGAAGG + Intergenic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
908300795 1:62759322-62759344 TTGTGGAGAATGGGGTATGAAGG + Intergenic
911049563 1:93659135-93659157 CTGGGGATAAGAGGGAATGAAGG + Intronic
911614518 1:99994446-99994468 CTGTGGGTAAGGGAGAATGGGGG - Intronic
911776265 1:101816824-101816846 CTGAGAATAAGGGTAGATGATGG - Intronic
912255170 1:108050986-108051008 CTGTGGGGAATGGGGGATGGAGG + Intergenic
913092701 1:115490330-115490352 CTGTGTGTGAGGGAGGATGAAGG + Intergenic
913528295 1:119713858-119713880 GTGGGGATAGGGAGGGATGAGGG + Intronic
915467175 1:156104549-156104571 CAGAGGATGAGTGGGGATGAAGG - Intronic
916114822 1:161477632-161477654 TTGTGGAAAATGGGGTATGAAGG + Intergenic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
918626256 1:186659135-186659157 CTGAGGAGAAGGTGGTATGATGG - Intergenic
921707862 1:218345158-218345180 CTGTGGGTAAGGGAGGAAGGAGG - Intergenic
922213095 1:223500300-223500322 CTGGGGATTGGGGGGAATGATGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
1062805076 10:413195-413217 CTGTGGATAAGAGGCCATGGAGG - Intronic
1063251102 10:4275951-4275973 CTGTGGATAAGGCAGGACTATGG + Intergenic
1063393055 10:5662523-5662545 CTGTCGAGAAGGGGGGGGGAGGG + Intronic
1063552357 10:7045018-7045040 CACTGGATAAGGAGTGATGATGG + Intergenic
1064341036 10:14485512-14485534 CTGTGTATATGTGGGGATGGGGG - Intergenic
1065242412 10:23720013-23720035 CTGGGGAGAAGGGGGGAGGGTGG + Intronic
1070267005 10:74913228-74913250 AGGTGGATAAGGGGGGACCATGG - Intronic
1070553710 10:77512277-77512299 CTATGGATAAGGGGGGACTGTGG - Intronic
1073569047 10:104560453-104560475 CAGTGGAGGAGTGGGGATGAAGG + Intergenic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073971136 10:109046327-109046349 TTGTGGAAAATGGGGTATGAAGG + Intergenic
1074793810 10:116920555-116920577 AACTGGATAAGGGTGGATGAGGG - Intronic
1076176773 10:128374324-128374346 CTGAGGATAATTGGGAATGATGG - Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077346131 11:2055799-2055821 GTGTGGATAATGGAGTATGAAGG - Intergenic
1077367206 11:2166059-2166081 CTGTGGAGCAGGGAGGATGAAGG + Intronic
1078001501 11:7500380-7500402 GTGTGCAGAAGGGTGGATGAGGG - Intronic
1078468491 11:11568497-11568519 CTCTGGTTAAGGGGGGAAAAAGG + Intronic
1079073401 11:17367707-17367729 CTGAGGATAAGGGGCTATCAGGG + Intronic
1079268980 11:18964317-18964339 CTGTGGATAGAGGGGAATGGGGG + Intergenic
1080703637 11:34667678-34667700 CTGTGAATATGGGGGGACCATGG - Intergenic
1084547930 11:69823674-69823696 CTGTGGATGAGGTGGGGTGGAGG + Intergenic
1085014606 11:73165051-73165073 CTGTAGATAAGGGAGGTGGAGGG - Intergenic
1085064757 11:73484077-73484099 CTGAAGATAAGGAGGGAGGAAGG - Intronic
1085129081 11:74022244-74022266 CTGTGGGTCATGGGGGATAAAGG + Intronic
1086751039 11:90493798-90493820 TTGTTGATCAAGGGGGATGAAGG + Intergenic
1087174305 11:95082067-95082089 CTGTTGTTATGTGGGGATGAGGG + Intergenic
1087632153 11:100662520-100662542 CCGTGGATAAGGAGGGACTACGG - Intergenic
1088505568 11:110523459-110523481 CTGTGGAAAGGGGTGGGTGATGG + Intergenic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090900434 11:131026159-131026181 CTGGGGATAAGAGGGGAAAAGGG + Intergenic
1091285201 11:134405041-134405063 CTGTGGATGAGGGAAGAGGAGGG + Intronic
1091693629 12:2613269-2613291 CTGTGGAGAAGGGGGAAGGGAGG + Intronic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1092279449 12:7088780-7088802 ATGGGGAAAAGGGGGGAAGAAGG - Intronic
1092489135 12:8929377-8929399 CTGTGGATAAGGAGGTAGGAAGG - Intronic
1092794395 12:12095645-12095667 CTAAGGATAATGTGGGATGAAGG - Intronic
1093250732 12:16801235-16801257 CTGGGGAGAATGGGGGATAACGG + Intergenic
1094001075 12:25694879-25694901 CAGTGAATAAGGGGGGACTATGG + Intergenic
1094441924 12:30487064-30487086 CTGGGGATAAGGGAGGAGCAGGG + Intergenic
1098776147 12:74620259-74620281 TTGTGGGGAAGGAGGGATGAGGG - Intergenic
1100448966 12:94687093-94687115 CTGGGGATAAGGAAGGATGATGG + Intergenic
1101567599 12:105922944-105922966 CTGGGGACTAGGGGAGATGAGGG + Intergenic
1101684046 12:106999558-106999580 CTGTGGATTAGTTGGGAAGAAGG - Exonic
1103088539 12:118080864-118080886 CTGGGGAAAAGAGGGAATGAGGG + Intronic
1103365073 12:120376235-120376257 CTGAGGATAAGGGGTGGTGGAGG - Intergenic
1103434635 12:120915259-120915281 GTGTGGGGAAGAGGGGATGAGGG + Intergenic
1103797788 12:123516712-123516734 TGGTGGATGAGGGGGGATGAGGG + Intronic
1105208066 13:18239485-18239507 CTGTGGAGAAGGGGGGATTTCGG + Intergenic
1106091702 13:26601474-26601496 GTATGGATGATGGGGGATGATGG + Intronic
1106167150 13:27257994-27258016 CTAGGGATCAGTGGGGATGAGGG - Intergenic
1106808097 13:33332176-33332198 CTGTGGATAGGTGGGGAGGTGGG - Intronic
1108285406 13:48902440-48902462 CTTTGAAAAAAGGGGGATGATGG + Intergenic
1108460031 13:50656566-50656588 CTCTGTATTAGAGGGGATGAAGG - Intronic
1108891459 13:55265875-55265897 CTATGGATAAGTGGGGACTACGG - Intergenic
1115304455 14:31919413-31919435 CTCTGGCTGAAGGGGGATGAGGG - Intergenic
1117164824 14:53022873-53022895 CTGAGGATAAGGGATGATCAGGG - Intergenic
1119730517 14:76948175-76948197 CTGTGGGTGAGGGGAGGTGAGGG - Intergenic
1121112574 14:91322220-91322242 CTGTGGGTACAGGGGGGTGATGG + Intronic
1121312370 14:92942051-92942073 CAGCAGATAAGGGGGGCTGAGGG + Intronic
1121679990 14:95785818-95785840 TTGTGGATACCGAGGGATGACGG + Intergenic
1122262633 14:100531900-100531922 CTGTGGGGAAAGGGGGCTGAGGG - Intergenic
1122376251 14:101261074-101261096 CTGTGGATAAAGGGGGATGATGG + Intergenic
1125365194 15:38905980-38906002 GAGTGGATAAGTGGGGATTAAGG - Intergenic
1125451951 15:39817805-39817827 CTGTGGAGCAGGGAGTATGACGG + Intronic
1127318195 15:57817340-57817362 GTGTGGCTGAGGGCGGATGAAGG - Intergenic
1127995984 15:64153334-64153356 CTGGGGGTAAGGGGGGCCGATGG + Exonic
1128533482 15:68471270-68471292 CTGTGGATATGGGGTGGTGCTGG - Intergenic
1128579044 15:68796016-68796038 GTGTGGAAAAGGGGAGATGAAGG + Intronic
1128744532 15:70104073-70104095 CTGTGGCTCAGAGGGGAGGAAGG + Intergenic
1129026961 15:72585327-72585349 ATATGGATAATGGGGGAAGAGGG - Exonic
1129188481 15:73924562-73924584 CTTTGGATGTGGGGGGATCAGGG - Intergenic
1129581478 15:76816055-76816077 CTCTGGGTAAGGGAGGGTGAGGG + Intronic
1129980554 15:79865643-79865665 CTGAGGGTAAGCAGGGATGAGGG - Intronic
1130405594 15:83598063-83598085 CTGTGGTTAAGGGGAAATAAGGG + Intronic
1131406803 15:92171763-92171785 CTGTGCCTAAAGGGGGAGGAGGG - Intronic
1131443428 15:92476020-92476042 CTTTGGATGTGGGGGTATGAGGG - Intronic
1132091692 15:98952567-98952589 CTGTGGTTTAGGGTGGGTGAGGG + Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG + Intergenic
1134901605 16:17943241-17943263 TGGTGGATAGGGTGGGATGAAGG - Intergenic
1135678590 16:24438206-24438228 CTGGGAATAAGGTGGGATGCAGG + Intergenic
1137238648 16:46636276-46636298 CTGTTGATAATGGGGGAGGCTGG + Intergenic
1138477081 16:57277741-57277763 CTGTGGTTAAGTGAGGATGTGGG + Intronic
1140376645 16:74450237-74450259 CTGTGGATGTGAGTGGATGATGG - Intergenic
1140688580 16:77458279-77458301 CTGAGTATATGGGGTGATGAAGG + Intergenic
1141489540 16:84362884-84362906 CTGTGGGTACGGCGGGAGGACGG - Intergenic
1142652562 17:1364822-1364844 CTGTGGATAAGGGGGGATGATGG + Intronic
1145832310 17:27926532-27926554 TTGGGAATAAGGGGGCATGATGG + Intergenic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146807160 17:35873848-35873870 CTGTGGCTCAGGGGAGTTGAGGG + Intronic
1147534703 17:41312089-41312111 ATGTGGAGAAGGGAGGTTGAGGG + Intergenic
1147757733 17:42779947-42779969 CTGTGGCCAAGGGGAGCTGAGGG + Intergenic
1148046398 17:44747637-44747659 CTGAGGATAAGGGGAAAGGAAGG - Intronic
1149347838 17:55756168-55756190 CTGGGGATAAGTGGTGAAGAAGG + Intronic
1149806240 17:59620201-59620223 CTGTGGAGAAGGTGGTAGGAAGG + Intronic
1151597767 17:75088444-75088466 CAGTGAATATGGGGGGATAAGGG + Intronic
1152235931 17:79138784-79138806 GTGTGGGTAAGGGGGCGTGAAGG - Intronic
1152562718 17:81086635-81086657 CTGTGGACGAGGGGGGCCGAGGG - Intronic
1153174373 18:2354398-2354420 CTGTGGATGAATGGTGATGATGG - Intergenic
1153661767 18:7331978-7332000 TTGTGGAGAAGGGGGCGTGAGGG - Intergenic
1154326769 18:13396865-13396887 CTGTGGATACAGAGGGCTGACGG + Intronic
1156510305 18:37630925-37630947 CTGGGGAAAAGGGGGGATGAAGG - Intergenic
1157928732 18:51795474-51795496 CTGTGGATAAGGGGGAACTATGG - Intergenic
1158680908 18:59565721-59565743 CTGTAGCTAAGAGGGGAAGACGG + Intronic
1159366402 18:67470939-67470961 GTGTGAATATGTGGGGATGAGGG + Intergenic
1160081434 18:75731155-75731177 CTGTCGGAAATGGGGGATGAAGG - Intergenic
1160831713 19:1107499-1107521 ATGTGGATGAGAGGGGACGAGGG - Intergenic
1161218235 19:3105383-3105405 CTGTGGATTTGGGGGGTTGGGGG + Intronic
1161282450 19:3453390-3453412 CCGTGGATGATGGTGGATGATGG + Intronic
1162675317 19:12294411-12294433 CTGGGGAGAAGCGGGGCTGAGGG + Intronic
1162687432 19:12399746-12399768 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162691745 19:12439589-12439611 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163822170 19:19502305-19502327 CAGTGGAGAAAGGGGGGTGACGG - Intronic
1164899904 19:31909685-31909707 TTGTGGAGAGGGGGTGATGATGG + Intergenic
1165148833 19:33749430-33749452 GTGGGGAGATGGGGGGATGATGG - Intronic
1168375614 19:55876866-55876888 CTGTGGATATGGAGGACTGACGG + Intronic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926931906 2:18049339-18049361 GTGTTGATTAGGTGGGATGATGG + Intronic
929330625 2:40676266-40676288 TTGTGGAGAATGGGGTATGAAGG + Intergenic
929600653 2:43202346-43202368 ATATGGATAATGGGGGAAGAAGG - Intergenic
929902881 2:46021070-46021092 CTGTGGAACAGGGTGGATGCTGG + Intronic
930380434 2:50621252-50621274 TTGTGGAGAAGGGGGGAGAAAGG + Intronic
930752909 2:54949446-54949468 CTGTGGCTGAGGGGAGTTGAGGG + Intronic
930842643 2:55864646-55864668 GTGGGGATAGTGGGGGATGAGGG + Intergenic
933921234 2:87048888-87048910 CTGTGGCTAAGTGTGGGTGATGG + Intergenic
933930400 2:87144909-87144931 CTGTGGCTAAGTGTGGGTGACGG - Intergenic
934001732 2:87720697-87720719 CTGTGGCTAAGTGTGGGTGATGG - Intergenic
934813401 2:97304013-97304035 CTGTGGAATAGCGGGGAAGAGGG - Intergenic
934824294 2:97404467-97404489 CTGTGGAATAGCGGGGAAGAGGG + Intergenic
934860365 2:97759486-97759508 GTGTGGATGAGGGAGGAAGAGGG + Intronic
934974362 2:98790214-98790236 CTGTGGAAAAGTGGGGGTGGAGG - Intergenic
935077861 2:99763196-99763218 CTGTGTTTAAAGGGGGATGTTGG - Intronic
936362730 2:111820539-111820561 CTGTGGCTAAGTGTGGGTGATGG + Intronic
936532446 2:113285855-113285877 CTGGGGAGAAGGGGCAATGAGGG + Intergenic
937151431 2:119689050-119689072 CTGTGGAGGAGTGGGGAGGATGG - Intergenic
941131789 2:161659987-161660009 CTGGGGTGAAGAGGGGATGAGGG + Intronic
941584402 2:167339409-167339431 GTGTGGATGTGGGGGGATGTAGG + Intergenic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
943834659 2:192503626-192503648 CTGGAGATAAGGGAGGAAGAAGG + Intergenic
944931529 2:204525248-204525270 CTGGGGATAAGTGGGGAAGTGGG + Intergenic
945188376 2:207163038-207163060 CTGAGTATAAGGGGTGGTGATGG - Intronic
945233912 2:207616881-207616903 CTGTGGCTGAGTGGGGCTGAAGG - Intronic
945409228 2:209488833-209488855 CTGGGGAAAGGGGGGGATGTGGG + Intronic
946017697 2:216617312-216617334 CTGTGGATGAGAGGGGGTGATGG + Intergenic
947976602 2:234371770-234371792 CTGGGGAGCAGGGGGGATTATGG + Intergenic
948856488 2:240732700-240732722 GAGGGGATGAGGGGGGATGAGGG + Intronic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1168764571 20:373005-373027 CTGAGGATAAAGGGGGAGGTGGG - Intronic
1171156449 20:22878910-22878932 ATGGGGATAATGAGGGATGAAGG - Intergenic
1171261734 20:23740022-23740044 CTGTGGAGAATGGGATATGAAGG + Intergenic
1171270876 20:23815913-23815935 CTGTGGAGAATGGGATATGAAGG + Intergenic
1172758528 20:37305509-37305531 CAGTGGGTAGGGGGGTATGATGG - Intronic
1173605518 20:44328208-44328230 ATGTGGAGGAGGGGGGAAGATGG - Intergenic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1175026506 20:55907960-55907982 CTGAGGAGGAGGGGGGTTGAAGG + Intergenic
1175874308 20:62222157-62222179 CTGTGGATGACAGGGGAGGAGGG - Intergenic
1175890183 20:62312533-62312555 CTGTGGGGAAGCGGGGATGCGGG + Intronic
1175946330 20:62560746-62560768 CTGGGGTTGAGGGGGGAGGAGGG + Intronic
1176026069 20:62986267-62986289 CTGAGGATGAGGTGGGATGGAGG + Intergenic
1178415772 21:32403868-32403890 CTGTGGATACGGGGTGGTGATGG + Intergenic
1179508793 21:41858748-41858770 CTGGGGAAGAGGGGGGTTGATGG + Intronic
1180758628 22:18181374-18181396 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1180768915 22:18365166-18365188 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1180777397 22:18497229-18497251 CTGTGGAGAAGGGGGGATTCCGG - Intergenic
1180810117 22:18754539-18754561 CTGTGGAGAAGGGGGGATTCCGG - Intergenic
1180826790 22:18868390-18868412 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1181177019 22:21043714-21043736 CTGTGGATAAGCTGGGTGGAGGG + Intergenic
1181196261 22:21188791-21188813 CTGTGGAGAAGGGGGGATTCCGG - Intergenic
1181213266 22:21304333-21304355 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1182016843 22:27047558-27047580 CTGAGGCTCAGGGAGGATGAGGG - Intergenic
1182630058 22:31678199-31678221 CTGTGGATAAGGAAGGAGGAGGG + Intronic
1182704383 22:32267292-32267314 ATGTGAATAAGGTGGGAGGAGGG + Intergenic
1183186529 22:36294745-36294767 CTGTTCATAAGGGAGGATTATGG - Intronic
1183321366 22:37167060-37167082 CTGGGGGTTAGGTGGGATGAGGG - Intronic
1184226236 22:43130235-43130257 CTGGGGATGAGGGGGGTTGGGGG - Intergenic
1184478510 22:44734524-44734546 CTCCGGATGAGGGGAGATGATGG + Intronic
1184662868 22:45973478-45973500 CCCTGGACTAGGGGGGATGAAGG - Intronic
1185149048 22:49153921-49153943 GTGTGGGTAAGGTGGGAGGAGGG + Intergenic
1185248978 22:49789687-49789709 CTGTGGAGAAGGTGGGCTGTAGG - Intronic
1203230537 22_KI270731v1_random:106050-106072 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
1203276931 22_KI270734v1_random:94300-94322 CTGTGGAGAAGGGGGGATTCCGG + Intergenic
949168872 3:974484-974506 CCGTGGATAAGGGAGGACTACGG - Intergenic
950099193 3:10346720-10346742 CAGTGGAAAAGGGTGGGTGAAGG + Intronic
950256446 3:11510523-11510545 CTTTGGAGATGGGGGGTTGAGGG - Intronic
950442795 3:13019663-13019685 CTGTGGTTAACTGGGGAGGATGG - Intronic
950763423 3:15255411-15255433 GTGGGGATGCGGGGGGATGAGGG - Exonic
953389599 3:42526686-42526708 AAGTGGTTAAGGGGGAATGAGGG - Intronic
954004528 3:47580201-47580223 CTGTAGATAAGATGAGATGATGG - Exonic
954317958 3:49811528-49811550 CTGTGGAACAGGGTGGATGGAGG - Intronic
954330960 3:49890061-49890083 CTGTGGAAAGGGGGAGGTGAGGG + Intronic
957326578 3:78703525-78703547 CTGAGGACTAGGGGGGCTGATGG - Intronic
958795374 3:98701516-98701538 GTGTGGAAAAGGGAGGAAGAAGG + Intergenic
961849976 3:129806428-129806450 CTTTGGAAATGGGTGGATGATGG - Intronic
965338307 3:167455425-167455447 CTGGGGATAAGGGGAAAGGAAGG - Intronic
968520124 4:1031365-1031387 CTGGGGAGAAGGGGGGCTGGTGG + Intergenic
969459136 4:7318680-7318702 CTGTGGATAAGGGGCTGTGTGGG - Intronic
970599910 4:17633625-17633647 CTGTAGATAAGAGGGGAAGTAGG - Exonic
971213628 4:24643475-24643497 CTCTGGAGAAGGGGAGATAAGGG - Intergenic
974123858 4:57671696-57671718 CTGTGGAGAAGGAGGCATGTAGG + Intergenic
976738456 4:88334269-88334291 AAGTGGATGAGGAGGGATGAGGG - Intergenic
977178632 4:93845731-93845753 CTGTGGATAACTGGTCATGAGGG + Intergenic
977286965 4:95120023-95120045 CTGTGGATTAACGGGGGTGAGGG - Intronic
978436645 4:108692795-108692817 CTGTGGATAGGGTGAGATCAAGG - Intergenic
980228852 4:130021897-130021919 TCGTGGATAAGGAGGGCTGATGG + Intergenic
980279454 4:130700646-130700668 GGGAGGGTAAGGGGGGATGAAGG - Intergenic
981694454 4:147546156-147546178 GTGTGGAGAAGGGGGGAGAAAGG - Intergenic
982701501 4:158663036-158663058 TTGTGGATAATGGGATATGAAGG + Intergenic
985017569 4:185652394-185652416 CTGTGGACAGGGGAGGATGGAGG + Intronic
985789262 5:1916448-1916470 CTGTGGAGACGTGGGGCTGAAGG - Intergenic
988591635 5:32554806-32554828 TTGTGGATAATGGGATATGAAGG - Intronic
989138193 5:38176186-38176208 CTGTGGAAAACGGGCCATGAAGG - Intergenic
990187020 5:53220334-53220356 CTGTACATAAGGGGGAATTAAGG + Intergenic
992827563 5:80566154-80566176 CTCTGGAAATGGGGGGATGGTGG + Intronic
995547748 5:113249804-113249826 CAGTGGATAAGGGGGCCTGAAGG - Intronic
997136214 5:131329166-131329188 CTGTGGCTAAGGGGCAATCAAGG + Intronic
997772139 5:136565113-136565135 CTGTGGAGAAGAGGGGACAATGG - Intergenic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
999434302 5:151551191-151551213 CTATGGGTATAGGGGGATGATGG - Intronic
1000953779 5:167517837-167517859 CTGGTGATGAGGGGGGTTGATGG + Intronic
1001525282 5:172424355-172424377 CTGTGGGTAGAGGGGAATGAGGG + Intronic
1001667837 5:173448104-173448126 CTGTGGACAAGGGGTGGTCAAGG - Intergenic
1001946378 5:175781839-175781861 CTATGGTTAAGGGGGGAAAATGG - Intergenic
1002357437 5:178642182-178642204 CTGTGGAAAATGGCAGATGAGGG - Intergenic
1003898001 6:10625708-10625730 CCGTGGATAAGGGGGGCCTACGG - Intronic
1005332614 6:24764410-24764432 CTGTGGAGAAGGAGGTAAGAGGG - Intergenic
1005380417 6:25228711-25228733 GGGTTGATAAGGGGTGATGATGG - Intergenic
1006522056 6:34576514-34576536 CTGTGGATCATGGTGGATGTCGG + Intergenic
1006683594 6:35814529-35814551 CTGTGGCTGAGGGGGAAGGAGGG - Exonic
1007018725 6:38497008-38497030 ATGTTGATAAGGGGGCATGCTGG - Intronic
1007447029 6:41914753-41914775 GTGTGGATGATGGGGGATGATGG - Intronic
1007450838 6:41939702-41939724 CTTGGGCTAAGGGGGGAAGAGGG + Intronic
1007928460 6:45668987-45669009 CTGTGGCTGATGGGGGATGAGGG - Intergenic
1008611520 6:53188621-53188643 CTGTGGATAAGGGAGCGGGAGGG + Intergenic
1011868473 6:91861837-91861859 CAGAGGCTAAGGGGGGAGGACGG + Intergenic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1015483408 6:133741266-133741288 CTGAGGCTAAGAGGGGCTGAGGG + Intergenic
1015994118 6:138980438-138980460 CTGTGGACAAGAGGGGAGAATGG - Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1018038641 6:159902987-159903009 CTGTGGAAAAGAAGGGCTGAGGG - Intergenic
1018777781 6:167034226-167034248 CTGTGGATTAAGAGGGATCAGGG + Intronic
1019374301 7:680989-681011 CCCTGGACAAGTGGGGATGATGG - Intronic
1019789292 7:3000361-3000383 CTGTGGGTAAGGGTGGTTGCTGG - Intronic
1023607765 7:41945566-41945588 CTGTGCATAAGGTGGGGTGGCGG - Intergenic
1024037823 7:45523743-45523765 TTGTGGAGAAAGGGAGATGAAGG + Intergenic
1024870429 7:53957652-53957674 TTGTGGAGAATGGGGTATGAAGG - Intergenic
1026352686 7:69531316-69531338 CTGTGGCAAAGGAGGGATGGGGG + Intergenic
1027024565 7:74841570-74841592 GTGTGGATGAGGGGGAAGGATGG - Intronic
1027063200 7:75102552-75102574 GTGTGGATGAGGGGGAAGGATGG + Intronic
1027333097 7:77120869-77120891 CGGTGGATAAGGGAGGACTACGG + Intergenic
1028093000 7:86726363-86726385 CTCTGGATAAGGGGAAATGATGG + Intronic
1029782692 7:102750432-102750454 CGGTGGATAAGGGAGGACTACGG - Intronic
1031616148 7:123882717-123882739 CTGAGGATTAGGTGGGCTGATGG - Intergenic
1031917740 7:127578914-127578936 CTGGGGGAAAAGGGGGATGAGGG + Intergenic
1033845932 7:145432151-145432173 CTGAGGAGAAGGAGAGATGAGGG + Intergenic
1034233103 7:149548027-149548049 CTGAGGATAAGGGTTAATGAGGG - Intergenic
1034445266 7:151110877-151110899 CTGTTGAAAATGGGGGATGCTGG + Intronic
1034974735 7:155441434-155441456 CTCTGGATGAAGGGGGCTGATGG - Intergenic
1035519864 8:267004-267026 CAGGGGATATGGGGGCATGAGGG + Intergenic
1036644352 8:10602441-10602463 CTGTGGACACGGGGGCAGGAGGG + Intergenic
1036966224 8:13301097-13301119 CTGTGGATACAGGAGGATAATGG + Intronic
1039617298 8:38966297-38966319 CTTTGGGGATGGGGGGATGAGGG + Intronic
1040482281 8:47836965-47836987 CTGTGGATTGGGAGGAATGAGGG + Intronic
1041124648 8:54622860-54622882 CTTTGGATAGGGGAGGAAGAGGG + Intronic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1042944962 8:74145263-74145285 CTGTGGATAAGGTGAGATGCAGG + Intergenic
1043877570 8:85503329-85503351 CTGTGGTTCAGTGGGGAGGAAGG - Intergenic
1044202832 8:89456754-89456776 CTGGGGATAAAAGGGTATGAAGG + Intergenic
1047742106 8:127814847-127814869 CTGTGGATACCAGGGGATGAGGG - Intergenic
1048209567 8:132443547-132443569 GTGTGGGTAGTGGGGGATGATGG - Intronic
1049300466 8:141866909-141866931 GTGGGGATCATGGGGGATGATGG + Intergenic
1049934007 9:483254-483276 CTGTGGATTAGAGGGGAGTATGG + Intronic
1055668380 9:78574923-78574945 GGGTGAATAAAGGGGGATGAAGG - Intergenic
1056011448 9:82335034-82335056 CAGAGGATAATGGGGGAAGAGGG - Intergenic
1058467008 9:105238765-105238787 CTTTGGATAAGTGAAGATGATGG - Intergenic
1186050759 X:5592418-5592440 CCGTGGATAAGGGGGAACGACGG + Intergenic
1186061953 X:5718588-5718610 CTGGTGATAAGGGAAGATGATGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1196649010 X:118149851-118149873 CAGTGGATACGGGGAGAAGATGG - Intergenic
1196746131 X:119073127-119073149 CTGTGGCTGAGGGGAGGTGAGGG - Intergenic
1196990848 X:121327023-121327045 CTGTGGATTAGGGGCCATGCTGG + Intergenic
1198777317 X:140193742-140193764 ACCTGGAGAAGGGGGGATGAAGG + Intergenic
1201430030 Y:13893981-13894003 TTGTGGAGAATGGGGTATGAAGG + Intergenic
1201515662 Y:14816686-14816708 TTGTGGAGAATGGGAGATGAAGG - Intronic
1201556084 Y:15265765-15265787 CTGTGGAAAATGGGATATGAGGG + Intergenic