ID: 1142653379

View in Genome Browser
Species Human (GRCh38)
Location 17:1372496-1372518
Sequence ATGATGAAGCTGAGTCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1586
Summary {0: 1, 1: 1, 2: 48, 3: 462, 4: 1074}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142653379_1142653382 8 Left 1142653379 17:1372496-1372518 CCTTCCTGACTCAGCTTCATCAT 0: 1
1: 1
2: 48
3: 462
4: 1074
Right 1142653382 17:1372527-1372549 TTTTATTTAAAGTGAGAGACTGG 0: 1
1: 6
2: 29
3: 226
4: 1610
1142653379_1142653383 9 Left 1142653379 17:1372496-1372518 CCTTCCTGACTCAGCTTCATCAT 0: 1
1: 1
2: 48
3: 462
4: 1074
Right 1142653383 17:1372528-1372550 TTTATTTAAAGTGAGAGACTGGG 0: 1
1: 1
2: 23
3: 106
4: 963

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142653379 Original CRISPR ATGATGAAGCTGAGTCAGGA AGG (reversed) Intronic
900388328 1:2420621-2420643 ATGAGGAAACTGAGTCAGAGAGG + Intergenic
901751056 1:11409010-11409032 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
901949427 1:12730268-12730290 ATGATTAAACTTAGTGAGGAAGG - Intergenic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902185899 1:14725240-14725262 TAGATGAAGGTGAGTGAGGAGGG - Intronic
902225664 1:14995016-14995038 AGGAGGAGGCTGAGTCAGTAGGG + Intronic
902597932 1:17521829-17521851 ATGGTGAAGCTGAGGTTGGAAGG + Intergenic
902928162 1:19711391-19711413 ATGATTAAGCTGAGTAAGAAAGG - Intronic
903558625 1:24211388-24211410 ATGAAGAAAGTGAGTCCGGAGGG + Intergenic
903582749 1:24384410-24384432 AGGAGGAAGCTGAGTCAGGTGGG - Intronic
903673955 1:25052915-25052937 ATGACAAAGCTCAGTCAGGGTGG + Intergenic
904170700 1:28590549-28590571 ATGTTGAAGCTGAGTCTCCAAGG - Intronic
904473397 1:30749550-30749572 ATCATGAAGATGAATCAGGCTGG + Intronic
904615731 1:31748549-31748571 AAGAGGAAGCTGAGCCAGGCAGG + Intronic
904665386 1:32116739-32116761 ATGATTAAGCTTAGTGAGGAAGG - Intronic
904761223 1:32805625-32805647 ATGATTAAGCTTAGTGAAGAAGG - Intronic
904776932 1:32915329-32915351 ATGATTAAGCTTACTGAGGAAGG - Intergenic
904787240 1:32992165-32992187 ATGGTGAAACTGAGGCAGGGGGG - Intergenic
904904109 1:33881607-33881629 ATGAAGGAGCTGAGTTGGGATGG + Intronic
905188923 1:36217969-36217991 ATGATTAAGCTTAATGAGGAAGG + Intergenic
905545869 1:38800288-38800310 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
906558824 1:46738596-46738618 ATGATTAAGCTTAGTGACGAAGG - Intergenic
906684709 1:47755926-47755948 ATGATGAAGATGAGGGAGGACGG - Intergenic
906836492 1:49087977-49087999 ATTATGAAGCTGAGTTTGGCTGG - Intronic
907039638 1:51246868-51246890 ATCAGGAAGCTGAGGCAGGAGGG + Intronic
907112978 1:51943497-51943519 ATAATTAAGCTTAGTGAGGAAGG + Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907355381 1:53868385-53868407 ATGAGGAAACTGAGACAGGAAGG - Intronic
907493834 1:54828437-54828459 CTCAGGAAGCTGAGACAGGATGG - Intronic
907548137 1:55280284-55280306 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
907651758 1:56302092-56302114 AAGATGAAGTTGAGTCAGAGTGG - Intergenic
907685089 1:56602825-56602847 ATGATTAAGCTTAGCGAGGAAGG + Intronic
907766136 1:57412358-57412380 ATGATTAAGCTTAGTGGGGAAGG + Intronic
907800255 1:57757798-57757820 ATGAAGAAGCTGAGTCTCCAAGG - Intronic
907802496 1:57784042-57784064 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
907965835 1:59328669-59328691 ATGATTAAGCTTAGTCAAGTAGG - Intronic
908221489 1:62011267-62011289 ATGATGAAACTTAGTGAGGAAGG - Intronic
908975401 1:69891161-69891183 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
909049227 1:70748379-70748401 AGGATGATGCTGAGTTAGGGAGG + Intergenic
909088450 1:71195604-71195626 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
909147287 1:71952158-71952180 ATGATTAAGGTTAGTGAGGAAGG + Intronic
909480831 1:76127911-76127933 AAGATGAAGCTGGGTCATGCAGG - Intronic
909513452 1:76481015-76481037 ATGATGATGCAAGGTCAGGAGGG - Intronic
909767203 1:79371414-79371436 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
909844066 1:80368211-80368233 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
909916090 1:81321432-81321454 ATGATGAAGCTTAGTGAGAAAGG - Intronic
909964348 1:81889195-81889217 ATGATTAAGCTTAGTGAGGAAGG + Intronic
910054855 1:83021282-83021304 ATGATGAAGCTTAGTGAGAAAGG - Intergenic
910072021 1:83228096-83228118 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910076401 1:83284752-83284774 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910078440 1:83309025-83309047 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
910151519 1:84152945-84152967 ATGATTAAGCTTAGTAAGGATGG - Intronic
910200457 1:84692958-84692980 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
910231726 1:84994875-84994897 GTGATTAAGCTTAGTGAGGAAGG - Intronic
910269832 1:85382074-85382096 ATTATGAAGCTTAGTGAGGAAGG + Intronic
910298403 1:85676496-85676518 ATGATTAAGCTTAGTGAGGAAGG - Intronic
910640091 1:89451036-89451058 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
910718663 1:90260244-90260266 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
910732705 1:90415503-90415525 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
910918199 1:92314209-92314231 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911199097 1:95026307-95026329 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911218500 1:95221545-95221567 AGGAGGAAGCTGACTCAGTATGG - Intronic
911296628 1:96125347-96125369 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
911503115 1:98713590-98713612 ATGATTAAACTTAGTGAGGAAGG - Intronic
911591394 1:99752290-99752312 ATGATTAAGCTTAGTGAGGAAGG - Intronic
911649627 1:100373107-100373129 ATGATTAAGCTTAGTGAAGAAGG - Intronic
911868406 1:103058526-103058548 ATGATTAAGCTTAGTGAGGAAGG - Intronic
912307194 1:108580444-108580466 ATGATTAAGCTTAGTGAGGAAGG + Intronic
912874002 1:113337254-113337276 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
912902496 1:113667720-113667742 TTGATTAAGCTTAGTGAGGAAGG - Intronic
912954142 1:114141161-114141183 ATAATGAAGCTTAGTGAGGATGG + Intronic
913207322 1:116552062-116552084 ATGATTAAGCTTAGTGAGGAAGG - Intronic
913308019 1:117452329-117452351 ATAATTAAGCTTAGTGAGGAAGG + Intronic
914436187 1:147661640-147661662 ATGATTAAGCTTAGTAAGGAAGG + Intronic
914774559 1:150724610-150724632 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
915125824 1:153663434-153663456 CTCAGGAGGCTGAGTCAGGAGGG - Intronic
915286724 1:154858005-154858027 AGGATGGAGTTGAGTCATGAGGG - Intronic
915676777 1:157539240-157539262 ATGATGAAACTGGTACAGGATGG + Exonic
915909571 1:159905396-159905418 ATGATTAAGCTCAGCAAGGAAGG - Intergenic
916191563 1:162184007-162184029 ATGATTAAGCCGGGTAAGGAAGG - Intronic
916553119 1:165868901-165868923 ATAATTAAGCTTAGTGAGGAAGG - Intronic
916566681 1:165985065-165985087 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
916799875 1:168206899-168206921 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
916948092 1:169749528-169749550 ATGATGAAGCTTAGTGAAAAAGG - Intronic
917115375 1:171597910-171597932 ATGATTAAGCTTAATGAGGAAGG + Intergenic
917192322 1:172431171-172431193 ATGATTAAGCTTAGTGAAGAAGG + Intronic
917238949 1:172926266-172926288 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
917359021 1:174156450-174156472 AGGATGAAGCTGACACATGATGG - Intergenic
917362366 1:174190789-174190811 ATGATTAAGCTTACTGAGGAAGG - Intronic
917766162 1:178219736-178219758 ATGATTAAGCTTAGTGAGGAAGG - Intronic
917793664 1:178516159-178516181 GTGATGAAGCTGAGTAAGAGGGG + Intronic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
917950909 1:180034915-180034937 ATGATTAAGCTTAGTGACGAAGG + Intronic
917983969 1:180295951-180295973 ATGATTAAGCTTAGTAATGAAGG + Intronic
917993542 1:180409868-180409890 ATGATTAAGCTTAGTGAGGAAGG + Intronic
918130682 1:181625844-181625866 ATGATTAAGCTTAGTGAGGAAGG - Intronic
918177508 1:182058615-182058637 AGAATGAGGGTGAGTCAGGAAGG + Intronic
918411582 1:184263983-184264005 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
918606147 1:186428652-186428674 ATGATTAAGCTAAATGAGGAAGG - Intergenic
919016832 1:192049241-192049263 ATGAAGAAGATAACTCAGGATGG + Intergenic
919113317 1:193247530-193247552 ATGATTAAGCTTAGTAAGGAAGG + Intronic
919185005 1:194134498-194134520 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
919335684 1:196229579-196229601 ATGATTATGCTTAGTGAGGAAGG + Intronic
919436067 1:197562722-197562744 ATGATGAAGCTTGTTGAGGAAGG + Intronic
919448816 1:197745294-197745316 GTGATAAAGCTTAGTGAGGAAGG - Intronic
919487863 1:198166457-198166479 ATGATTAAGCTTAGTGAGAAAGG - Intronic
919641889 1:200053430-200053452 ATGAAGAAACTGAGGCAGAAGGG + Intronic
920024332 1:202982169-202982191 ATGATGAAGCTTAGCAAGGACGG - Intergenic
920034474 1:203056914-203056936 CTGATCCAGCTGAGTCGGGATGG + Exonic
920538324 1:206756520-206756542 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
920976461 1:210790454-210790476 ATCATGAAGCAGAGTCTGTAAGG - Intronic
921091029 1:211843270-211843292 ATAATGAAGCTTAGTGAGGAAGG - Intergenic
921141901 1:212316177-212316199 ATGATTAAGCTTAGTGAGGAAGG + Intronic
921204167 1:212833911-212833933 ATGATTAAGCTTAGTGAGGAAGG - Intronic
921224385 1:213003390-213003412 ATGATTAAGCTTAGCAAGGAAGG - Intronic
921276182 1:213523011-213523033 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
921282021 1:213576776-213576798 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
921292199 1:213669193-213669215 ACGATTAAGCTTAGTAAGGAAGG - Intergenic
921303944 1:213777253-213777275 ATGATTAAGCTTAGTGGGGAAGG - Intergenic
921307945 1:213815868-213815890 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
921308238 1:213818242-213818264 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
921398735 1:214696441-214696463 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
921492583 1:215796732-215796754 ATGATTAAGCTTATTGAGGAAGG + Intronic
921537981 1:216375754-216375776 ATGAGTAAGCTTAGTGAGGAAGG - Intronic
921571736 1:216787698-216787720 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
921609796 1:217197913-217197935 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
921828868 1:219704460-219704482 ATGATTAAGTTTAGTGAGGAAGG + Intronic
922032482 1:221815019-221815041 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
922065582 1:222136307-222136329 ATGATTAAACTTAGTGAGGAAGG - Intergenic
922333165 1:224595617-224595639 ATGATTTAGCTTAGTGAGGAAGG + Intronic
922389533 1:225125828-225125850 ATGATTAAGCTTAATAAGGAAGG - Intronic
922588659 1:226755367-226755389 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
922627113 1:227059919-227059941 TGGCTGAAGTTGAGTCAGGATGG - Intronic
922659047 1:227413334-227413356 ATGATTATGCTTAGTAAGGAAGG - Intergenic
922727948 1:227933562-227933584 ATGATTAAGATTAGTGAGGAAGG - Intronic
922823387 1:228500585-228500607 ATGATCAATCTTAGTGAGGAAGG - Intergenic
922853281 1:228752680-228752702 ATAATGAAGCTGATTAAAGAGGG + Intergenic
922959213 1:229631478-229631500 ATAATTAAGCTTAGTGAGGAAGG - Intronic
923014678 1:230117425-230117447 ATGATTAAGCTTAGTGAGGAAGG - Intronic
923371995 1:233323868-233323890 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
923763175 1:236866575-236866597 ATGATTAAGTTTAGTGAGGAAGG + Intronic
923898293 1:238297159-238297181 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
923936449 1:238765587-238765609 ATGATGAAGCTTAGTGAAGAAGG - Intergenic
924258918 1:242210125-242210147 ATGATGAACCTCAGTGAGAAAGG + Intronic
924499838 1:244627000-244627022 ATGATTAAGCTTAGTGAGGAAGG - Intronic
924756926 1:246949642-246949664 AACATGCAGCTCAGTCAGGAAGG - Intronic
924878723 1:248134728-248134750 ATGTTGAAGCATAGTAAGGAAGG + Intergenic
1062777214 10:162013-162035 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062893898 10:1088342-1088364 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1062995635 10:1863732-1863754 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1063337616 10:5231592-5231614 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1063788565 10:9412977-9412999 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1064002031 10:11671767-11671789 ATGATGAAGCGTAGTGAGGAAGG - Intergenic
1064066668 10:12188029-12188051 CTCAGGAAGCTGAGGCAGGAGGG + Intronic
1065059254 10:21881402-21881424 ATGATTAAGCTTAGTTCGGAAGG - Intronic
1065064818 10:21950584-21950606 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1065699982 10:28415485-28415507 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1066043377 10:31575773-31575795 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066134934 10:32435942-32435964 ATGATTAAGCTGACTGAGGAAGG - Intergenic
1066266903 10:33784815-33784837 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1066478959 10:35776883-35776905 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1067444017 10:46329405-46329427 ACGCTGGAGCTGAGTCTGGAAGG + Intronic
1067548145 10:47211355-47211377 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1068092967 10:52455360-52455382 CTGAAGAAGGTGAGTCAGAAAGG - Intergenic
1068127105 10:52853919-52853941 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1068220279 10:54035756-54035778 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1068222580 10:54063379-54063401 ATGCTGAAGTTGACTCAAGAAGG - Intronic
1068735547 10:60409928-60409950 ATGATGAAGCTGAGAGACTAGGG - Intronic
1068748730 10:60566374-60566396 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1068769637 10:60806644-60806666 CTTAGGAAGCTGAGGCAGGAAGG - Intergenic
1068860785 10:61845834-61845856 ATGATCTGGCTGAGGCAGGAGGG + Intergenic
1068870112 10:61934443-61934465 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1068912803 10:62396541-62396563 ATGATAAAGATGAGTAAAGATGG - Intronic
1068940890 10:62680019-62680041 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1069304008 10:66945691-66945713 ATGATAAAGCTTAATGAGGAAGG - Intronic
1069319047 10:67144913-67144935 ATGCTTAAGCTTAGTTAGGAAGG - Intronic
1069736401 10:70657853-70657875 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1069947177 10:71995522-71995544 ATGATGGAGCTTAGTGAGGCAGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070420780 10:76235042-76235064 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1070984384 10:80675609-80675631 ATGATTAAGCTTAGTAAGGAGGG + Intergenic
1071132726 10:82414135-82414157 ATGATTAAGCTTAGTGAGGGAGG - Intronic
1071436271 10:85650699-85650721 AACATTAAGCTGAGTCAGAAAGG + Intronic
1071662990 10:87524593-87524615 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1071683324 10:87729671-87729693 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1071851634 10:89577597-89577619 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1071869924 10:89782475-89782497 ATGATGACCCTGAGTCAGTAAGG + Intergenic
1071871819 10:89803882-89803904 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1071982914 10:91021915-91021937 ATGCTGAGGCTGAGTGAAGAAGG - Intergenic
1072005939 10:91247571-91247593 ATGAAGGAGATGAGGCAGGAAGG + Intronic
1072166681 10:92820301-92820323 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1072186463 10:93044083-93044105 ATGCTGAAGCTGATTCACTAAGG - Intronic
1072325736 10:94296833-94296855 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1072428401 10:95349933-95349955 CTGAGGAGGCTGAGGCAGGAGGG - Intronic
1072473999 10:95741129-95741151 ATGATTAAGCTTAGCAAGGAAGG - Intronic
1072539525 10:96387681-96387703 ATAATGAGGCTGAGTTAGCAGGG + Intronic
1072601024 10:96929724-96929746 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1072618861 10:97066995-97067017 CTGAGCAAGCTGACTCAGGAAGG + Intronic
1072889651 10:99311761-99311783 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1073091173 10:100940941-100940963 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1073615096 10:104986570-104986592 ATGATTAAGCTCAGTAAGGAAGG - Intronic
1073681511 10:105709228-105709250 ATGATTAAGCTTAGTGAGCAAGG + Intergenic
1073696305 10:105872918-105872940 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1073878554 10:107952593-107952615 ACGTTGTTGCTGAGTCAGGAGGG + Intergenic
1074090918 10:110254520-110254542 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1074210714 10:111331679-111331701 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074607248 10:114985531-114985553 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1074649848 10:115508424-115508446 GTGATTAAGCTTAGTGAGGAGGG + Intronic
1074691476 10:116008866-116008888 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1074905253 10:117856686-117856708 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1075010128 10:118860792-118860814 ATGATTAAGTTGAGTGAGGTAGG + Intergenic
1075034716 10:119054798-119054820 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1075178940 10:120192356-120192378 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1075439727 10:122470279-122470301 ATGAGGAAACTGAGGCAGAAGGG - Intronic
1075490750 10:122866905-122866927 ATGATTAAGCTTAGTGAGTAAGG + Intronic
1075596523 10:123734270-123734292 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1075668366 10:124246361-124246383 ATGAGGAAACTGAGGCATGAAGG - Intergenic
1075751218 10:124773073-124773095 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1076251701 10:128989398-128989420 GTGATTAAGGTCAGTCAGGATGG - Intergenic
1076276398 10:129202952-129202974 GTGATTAAGCTGAGTAAGGAAGG - Intergenic
1076293834 10:129368492-129368514 ATGAGGAAACTGAGGCAGGGAGG + Intergenic
1076513453 10:131028669-131028691 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1076549509 10:131269068-131269090 ATAATTAAGCTGAGTGAAGAAGG - Intronic
1076693591 10:132236401-132236423 ATGAGGAAGCTGAGGCTGGGTGG + Intronic
1076742701 10:132494930-132494952 ATTATTAAGCTGAGGGAGGAAGG + Intergenic
1078122938 11:8529013-8529035 ATGAGGAAACTAAGTCAGTATGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078151616 11:8764475-8764497 ATGAAGAAGCTGAGGCTGAAAGG + Intronic
1078193648 11:9115752-9115774 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1078398931 11:11006912-11006934 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1078732264 11:13985729-13985751 ATGATGAAACTGAGTCCCCAAGG + Intronic
1079132905 11:17759515-17759537 ATGATTACGCTTAGTGAGGAAGG - Intronic
1079251214 11:18789596-18789618 ATCATGGAGCTGAGCCAGGGTGG - Intronic
1079647980 11:22891370-22891392 AAGATAGAACTGAGTCAGGAGGG + Intergenic
1080073396 11:28116876-28116898 CTCAGGAAGCTGAGACAGGAAGG - Intronic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1080842311 11:35996142-35996164 ATGGTTAAGCTTAGTGAGGAAGG - Intronic
1081212013 11:40347527-40347549 ATGACTAAGCTTAGTAAGGAAGG - Intronic
1081233346 11:40614643-40614665 ATGATTAAGCTCAGTGAAGAAGG - Intronic
1081410395 11:42750923-42750945 CTAATGAAGCTTAGTGAGGAAGG + Intergenic
1081485721 11:43526647-43526669 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1082128609 11:48460603-48460625 ATGATGAAGATGGGTCTTGAGGG + Intergenic
1082200019 11:49355223-49355245 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1082230026 11:49752372-49752394 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1082248794 11:49956843-49956865 ATGATGAAGATGGGTCTTGAGGG - Intergenic
1082562154 11:54631538-54631560 ATGATGAAGATGGGTCTTGAGGG + Intergenic
1082565142 11:54667963-54667985 CTGAAGAATCTTAGTCAGGAAGG + Intergenic
1082761827 11:57134650-57134672 ATGATTAAGCTTAGTGAGCAAGG - Intergenic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1082923062 11:58516864-58516886 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1083040116 11:59677723-59677745 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1083071436 11:59987382-59987404 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1083185863 11:61017542-61017564 TGGAGGAAGGTGAGTCAGGATGG + Exonic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083976064 11:66121452-66121474 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1084369246 11:68728152-68728174 AAGATTAAGCTTAGTGAGGAAGG + Intronic
1084617491 11:70246245-70246267 ATGGGGCAGCTGAGCCAGGAAGG - Intergenic
1084668189 11:70588324-70588346 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1085196522 11:74675497-74675519 ATGAGGAAACTGAGGCAGAAAGG + Intergenic
1085441187 11:76564395-76564417 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1086034530 11:82400685-82400707 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086121633 11:83310830-83310852 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1086187156 11:84032201-84032223 ATGATTATGCTTAGTGAGGAAGG + Intronic
1086231528 11:84576465-84576487 ATGATCAAGCTGAGCCTTGAAGG + Intronic
1086273353 11:85094879-85094901 ATGATTAAACTTAGTGAGGAAGG - Intronic
1086302497 11:85442772-85442794 TTCAGGAAGCTGAGGCAGGAAGG + Intronic
1086323553 11:85675261-85675283 ATGATTAAACTTAGTGAGGATGG - Intronic
1086620032 11:88876577-88876599 ATGATTAAGCTTAATGAGGAAGG - Intronic
1086646959 11:89234512-89234534 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1086896949 11:92324307-92324329 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1086900139 11:92358063-92358085 CTCAGGAAGCTGAGGCAGGAAGG + Intronic
1087156034 11:94904888-94904910 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1087651029 11:100867778-100867800 ATCATTAAGCTTAGTGAGGAAGG - Intronic
1087665651 11:101044600-101044622 ATGATTAAGCTTAATTAGGAAGG - Intronic
1087727939 11:101743718-101743740 ATGTTTAAGCTGGCTCAGGATGG - Intronic
1087784424 11:102338867-102338889 AGAATGAGGCTGAGACAGGAGGG + Intronic
1087913935 11:103786247-103786269 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
1088120539 11:106363783-106363805 ATGAAGAAACTGAGGCAGGGAGG - Intergenic
1088157004 11:106818623-106818645 ATGATTAAGCTTAGTAAGAAAGG + Intronic
1088439679 11:109855932-109855954 ATGATTAAGCTTAGTGAGAACGG - Intergenic
1088505753 11:110525415-110525437 ATCAGGAGGCTGAGGCAGGAGGG + Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088995692 11:114994584-114994606 ATGATGAAGTGGAATCAGGCTGG + Intergenic
1089415271 11:118283916-118283938 ATGAGTAAGCTTAGTGAGGAAGG + Intergenic
1089724347 11:120462116-120462138 ATGATTAAGTTTAGTAAGGAAGG - Intronic
1089823736 11:121252545-121252567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1090031421 11:123209794-123209816 ATGATGAAGCTGACTTGGGGTGG - Intergenic
1090260903 11:125319081-125319103 ATGATTAAGCTTAGTGAGGGAGG - Intronic
1090738041 11:129629468-129629490 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1090813157 11:130265507-130265529 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1091148905 11:133307571-133307593 ATGTTTGACCTGAGTCAGGAAGG - Intronic
1091284097 11:134398564-134398586 ATGAAGAAACTGAGGCATGAGGG + Intronic
1091515568 12:1177332-1177354 AAGATTAAGCTTAGTGAGGAAGG - Intronic
1091748086 12:3005399-3005421 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1092622937 12:10293302-10293324 ATGAATAAGCTTAGTGAGGAAGG - Intergenic
1092982569 12:13811339-13811361 TTTAGGAAGCTGAGCCAGGAGGG + Intronic
1093221881 12:16431396-16431418 ATGATTAAGTTCAGTGAGGAAGG - Intronic
1093252560 12:16825311-16825333 ATGATTAAGCTTAGTGAGGCAGG + Intergenic
1093427557 12:19045529-19045551 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1093450935 12:19312873-19312895 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1093617170 12:21240321-21240343 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1093791216 12:23252578-23252600 GTGAGGAAACTGAGTCATGAGGG + Intergenic
1094112507 12:26876543-26876565 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1094158623 12:27365318-27365340 AGGATGAAACTTAGTCATGATGG + Intronic
1094196183 12:27752142-27752164 ATCAGGAGGCTGAGGCAGGAGGG + Intronic
1094205369 12:27834026-27834048 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1094280096 12:28727412-28727434 ACGATTAAGCTTAGTGAGGAAGG - Intergenic
1094632655 12:32192012-32192034 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1094637047 12:32236626-32236648 ATGATTATGCTTAGTGAGGAAGG + Intronic
1095284743 12:40395553-40395575 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095308420 12:40664848-40664870 AGGATTAAGCTTAGTGAGGAAGG + Intergenic
1095435508 12:42183341-42183363 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1095518404 12:43033149-43033171 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095605972 12:44068375-44068397 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1095657846 12:44691566-44691588 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1095688108 12:45058740-45058762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1095936801 12:47692777-47692799 ATGATTAAACTTAGTGAGGACGG - Intronic
1096000307 12:48124199-48124221 ATGAAGAAACTGAGGAAGGAGGG + Intronic
1096013268 12:48241985-48242007 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1096440344 12:51637345-51637367 ATGATTAAACTTAGTGAGGAAGG + Intronic
1096441599 12:51648308-51648330 CTGAGGAGGCTGAGGCAGGAGGG - Intronic
1096627889 12:52906476-52906498 ATTATCAAAGTGAGTCAGGAGGG + Intronic
1096672818 12:53210496-53210518 GTGAGGGAGCTGAGTGAGGAGGG - Intergenic
1096741478 12:53696907-53696929 TTGAGGAAGCTGAGCCAGAAGGG - Intergenic
1097123651 12:56755417-56755439 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1097371933 12:58794566-58794588 AAGATGAGGCTGGGTCAGCATGG + Intronic
1097672018 12:62551209-62551231 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1097936419 12:65257144-65257166 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1097954745 12:65472122-65472144 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1098041958 12:66361724-66361746 AAGCAGAGGCTGAGTCAGGAGGG - Intronic
1098075184 12:66722204-66722226 ATGATTAAGCTTATTGAGGAAGG - Intronic
1098206639 12:68117837-68117859 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1098752066 12:74306199-74306221 ATGATTAATCTTAGTGAGGAAGG - Intergenic
1098800675 12:74953434-74953456 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1098879604 12:75903623-75903645 ATCCTGATGCTGAGTGAGGAGGG + Intergenic
1098921761 12:76309032-76309054 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1098936739 12:76488862-76488884 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1099003514 12:77209534-77209556 ATGATTAAGCTTTGTAAGGAAGG - Intergenic
1099119890 12:78675763-78675785 CTGATGAAGCTGAGTCCTCACGG + Intergenic
1099162019 12:79253660-79253682 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1099609114 12:84843723-84843745 ATGATTAAGCTTATTGAGGAAGG + Intergenic
1099934227 12:89106570-89106592 TAGATGAAGTTGAGCCAGGACGG + Intergenic
1099938065 12:89151790-89151812 ATGACTAAGCTTAGTTAGGAAGG + Intergenic
1100117480 12:91325004-91325026 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1100257005 12:92894386-92894408 ATGATTAAGCTTAATGAGGAAGG + Intronic
1100295307 12:93255483-93255505 CTGATGAAGCTGGTTTAGGATGG - Intergenic
1100356060 12:93831112-93831134 ATCAGGAGGCTGAGGCAGGAGGG + Intronic
1100468287 12:94868270-94868292 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1100516422 12:95332636-95332658 ATGATTAAGCTTAGTGAGAAGGG - Intergenic
1100695616 12:97089572-97089594 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1101215198 12:102574710-102574732 ATGATGGAGCTGAGGCTGGTAGG + Intergenic
1101413015 12:104484849-104484871 ATGCTGAAGCTAAGACATGAAGG + Intronic
1101562169 12:105867267-105867289 ATGATTAAGCTTAGTAAAGAAGG + Intergenic
1101620569 12:106383403-106383425 ATGATTAAGCTTAGAAAGGAAGG - Intronic
1101684061 12:106999641-106999663 CTGACGAAGCTGTGTCATGATGG + Exonic
1101934888 12:109049215-109049237 ATGATTAAGCTCAGTGAGGAAGG - Intronic
1101950980 12:109174760-109174782 CTGAGGAGGCTGAGGCAGGAGGG + Intronic
1102654059 12:114465393-114465415 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1103922685 12:124407302-124407324 ATGATGCAGATGAGGCAGCAAGG + Intronic
1104395742 12:128431012-128431034 ATGATGAAGCTTCATGAGGAAGG + Intronic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104534049 12:129601517-129601539 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1104666627 12:130652021-130652043 AAGATAAAGCTGAGGCAGGAGGG - Intronic
1104915892 12:132264357-132264379 ATGAAGAAGCCGAGCCGGGATGG + Intronic
1105325033 13:19363110-19363132 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1105547644 13:21362782-21362804 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1105746995 13:23386713-23386735 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1105780077 13:23697912-23697934 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1105833549 13:24187927-24187949 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1105983644 13:25544767-25544789 ATGATGAAGCTGGGCCAGAAAGG + Intronic
1106987696 13:35374086-35374108 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1107014754 13:35699146-35699168 ATGAGGACGATGAGTCTGGAGGG - Intergenic
1107143722 13:37034209-37034231 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1107175328 13:37393332-37393354 ATGATTAAGCTTAGCAAGGAAGG + Intergenic
1107287288 13:38808438-38808460 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1107459078 13:40583915-40583937 ATGATTCAGCTTAGTGAGGAAGG - Intronic
1108010334 13:46000792-46000814 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1108181372 13:47843163-47843185 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1108274439 13:48793233-48793255 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1108278059 13:48831468-48831490 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1108602029 13:52003205-52003227 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1108909245 13:55522368-55522390 ATGATTAAGCTTAGTCAGGAAGG - Intergenic
1108926475 13:55753469-55753491 ATGATTAAGCTTAGTAAGGTAGG + Intergenic
1109254684 13:60064804-60064826 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1109265840 13:60199357-60199379 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1109515465 13:63438202-63438224 ACGATTAAGCTTAGTGAGGAAGG - Intergenic
1109556643 13:63984695-63984717 ATAATTAAGCTAAGTAAGGAAGG - Intergenic
1109616531 13:64841233-64841255 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
1109700831 13:66022653-66022675 ATGATTAAGCTCAGTAAGGAAGG + Intergenic
1109815616 13:67579313-67579335 ATGATTAAGTTTAGTGAGGATGG - Intergenic
1109853567 13:68100884-68100906 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1109953297 13:69531109-69531131 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1110382496 13:74869884-74869906 TTGATTAAGCTTAGTGAGGAAGG - Intergenic
1110411646 13:75210308-75210330 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1110447263 13:75599844-75599866 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1110735535 13:78931771-78931793 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1110829560 13:80014699-80014721 ATGATCAAGCGTAGTAAGGAAGG + Intergenic
1110841477 13:80148455-80148477 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1111140406 13:84111034-84111056 ATGAAGAAACTGAGCCAGGTGGG + Intergenic
1111220173 13:85194593-85194615 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1111366028 13:87246100-87246122 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1111571714 13:90096586-90096608 ATGATTAAACTTAGTGAGGATGG - Intergenic
1111787385 13:92806524-92806546 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1111839959 13:93437326-93437348 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1112208806 13:97352299-97352321 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1112521162 13:100096560-100096582 ATCATTAAGCTTAGTGAGGAAGG + Intronic
1112728824 13:102336132-102336154 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1113097178 13:106678320-106678342 CTGATGAAGATGAGGCAGGATGG + Intergenic
1113706376 13:112435806-112435828 ATGAGGAAACTGAGGCAGCAAGG + Intergenic
1114036959 14:18638257-18638279 AAGATAGAGATGAGTCAGGATGG - Intergenic
1114121682 14:19676787-19676809 AAGATAGAGATGAGTCAGGATGG + Intergenic
1114223750 14:20720036-20720058 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1114550931 14:23532547-23532569 AAGGTGAGGCTGGGTCAGGAAGG - Exonic
1114585470 14:23808895-23808917 ATGAGTAAGCTTAGTAAGGAAGG + Intergenic
1114815434 14:25952415-25952437 ATGATTAAGCATAGTAAGGAAGG - Intergenic
1114943317 14:27644327-27644349 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
1114977298 14:28117900-28117922 ATGATTAATCTTAGTGAGGAAGG + Intergenic
1115308251 14:31953967-31953989 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1115419077 14:33171822-33171844 ACGATGAAGCTTAGTGAGAAAGG - Intronic
1115468579 14:33744172-33744194 ATGATGAAGCTTAGTGAATAAGG - Intronic
1115709550 14:36035803-36035825 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1116091678 14:40315712-40315734 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1116562157 14:46394136-46394158 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1116587249 14:46723013-46723035 AAGATGAAAGTGAGTCAGAATGG - Intergenic
1116592345 14:46794213-46794235 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1116924907 14:50624656-50624678 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1117201706 14:53396423-53396445 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117231259 14:53721207-53721229 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1117269596 14:54128628-54128650 ATGATTAAGCTTAGTGATGAAGG + Intergenic
1117401439 14:55362062-55362084 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1117519558 14:56537236-56537258 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1117586956 14:57217741-57217763 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118125018 14:62892079-62892101 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1118507733 14:66432568-66432590 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1118518089 14:66548748-66548770 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1118560446 14:67074622-67074644 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1118692985 14:68357868-68357890 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1118927963 14:70211095-70211117 ATGATTAAGCCAAGTGAGGAAGG - Intergenic
1119017268 14:71071772-71071794 ATAAGGAAGCTTAGTGAGGAAGG - Intronic
1119170583 14:72532523-72532545 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1119470928 14:74898650-74898672 ATCATGATGCTGCTTCAGGAAGG - Intronic
1119883358 14:78119784-78119806 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1120049167 14:79845384-79845406 ATGATTGAGCTTAGTGAGGAAGG - Intronic
1120058658 14:79955444-79955466 ATGATGAAGCTTAGTGTGGCTGG - Intergenic
1120264708 14:82234140-82234162 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1120396704 14:83976061-83976083 ATCATCAAGCTCACTCAGGAAGG - Intergenic
1120563667 14:86028383-86028405 AAGGTGAAGCTGGGTCATGAAGG + Intergenic
1121018673 14:90565370-90565392 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1121170880 14:91853299-91853321 ATAATGAAGGTGAGAGAGGAAGG + Intronic
1121296261 14:92827646-92827668 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1121461480 14:94081975-94081997 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1121494298 14:94381262-94381284 ATGATGAAGCTGAGCCTCGAGGG - Intronic
1121705082 14:95986538-95986560 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1121805010 14:96810657-96810679 CAAATGAAGCTGAGTCAAGACGG - Intronic
1121930561 14:97968167-97968189 ATGAAGAAGCTAAGGCATGAGGG + Intronic
1122001392 14:98658244-98658266 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1122054528 14:99084537-99084559 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1122201305 14:100124237-100124259 CTGACAAAGCTGAGTGAGGAAGG - Intronic
1122232305 14:100312823-100312845 ATGACAAACCTGAGGCAGGAAGG - Intergenic
1122522735 14:102357054-102357076 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1123027022 14:105430162-105430184 ATGACTAAGCTTAGTTAGGAAGG - Intronic
1123109960 14:105862269-105862291 ATGATGAATTAGAGTCAAGATGG - Intergenic
1124008139 15:25810973-25810995 ATAATGAAGCTGGGGCTGGAAGG + Intronic
1124093358 15:26626431-26626453 ATGATTAAGCTTAGTGAGGGAGG + Intronic
1124100057 15:26684546-26684568 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1124391903 15:29266983-29267005 AGGAGAAAGCTGAGTCAGGGAGG + Intronic
1124397177 15:29312853-29312875 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1124670795 15:31636595-31636617 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
1124901608 15:33828385-33828407 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1124950352 15:34313150-34313172 ATGATTAAGCTCAGTGAGAAAGG + Intronic
1124950545 15:34315477-34315499 CTTAGGAAGCTGAGGCAGGAGGG + Intronic
1125000543 15:34765506-34765528 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1125252753 15:37724725-37724747 ATGAGGAGGCTTAGTAAGGAAGG - Intergenic
1125261033 15:37824948-37824970 AAGTAGAAGCTGAGTCATGAGGG - Intergenic
1125651986 15:41324834-41324856 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1125870593 15:43098002-43098024 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1125875370 15:43139459-43139481 ATGATGAAGCTTGGTGAGGAAGG + Intronic
1126240363 15:46435189-46435211 ACGATGAAGCTTAGTGAAGAAGG + Intergenic
1126391713 15:48163010-48163032 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1126828277 15:52572621-52572643 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
1127206206 15:56721935-56721957 ATTATTAAGCTTAGTGAGGAAGG - Intronic
1127447109 15:59074821-59074843 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1127628193 15:60800828-60800850 ATGCTGGAGTTGAGACAGGAAGG - Intronic
1127705195 15:61539962-61539984 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1127717571 15:61664461-61664483 ATGAGGAAACCAAGTCAGGAAGG + Intergenic
1127837286 15:62800144-62800166 AGGCTGAAGCTGAGCCAGAACGG - Intronic
1127948605 15:63781723-63781745 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1128173920 15:65536840-65536862 ATCATTAAGCTTAGTGAGGAAGG + Intronic
1128189932 15:65682698-65682720 ATGATTAAGCTTAATGAGGAAGG - Intronic
1128253970 15:66183739-66183761 ATGCAGATTCTGAGTCAGGAGGG + Intronic
1128629337 15:69247620-69247642 ATGATTAAGCTCAGTGAGGAGGG - Intronic
1128871258 15:71156951-71156973 ATGATGCAGCAGAGTAAGCAGGG - Intronic
1129126423 15:73445539-73445561 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1129289797 15:74556110-74556132 ATTATTAAGCTTAGTGAGGAAGG - Intronic
1129329085 15:74817631-74817653 AGAATGCAGCTGACTCAGGACGG - Intronic
1129499314 15:76020322-76020344 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1129948835 15:79567554-79567576 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1130120655 15:81044891-81044913 AAGATGAGGCTTAGACAGGATGG - Intronic
1130408132 15:83621279-83621301 ATGATTAAGCTTAGTGAGGGAGG - Intergenic
1130800080 15:87253997-87254019 CTGATGAAGCTTAGTTAGGCTGG + Intergenic
1131169655 15:90168541-90168563 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1131172350 15:90187435-90187457 ATGAAAAAGCTGAGTTAGGCAGG + Intronic
1131329676 15:91485412-91485434 ATGAGGAAGCAGAGTGAGAAAGG + Intergenic
1131405677 15:92162528-92162550 ATGAGGAAACTAAGGCAGGAGGG + Intronic
1131610450 15:93955695-93955717 ATGGTGAAACTGAGTCAGGCAGG - Intergenic
1131666760 15:94579317-94579339 ATTCTGAAGCTCAGCCAGGATGG + Intergenic
1131679922 15:94710569-94710591 CTCAGGAAGCTGAGGCAGGAAGG - Intergenic
1131755714 15:95558879-95558901 ATGTTGATGCTGAGGCAGTATGG - Intergenic
1131756558 15:95569909-95569931 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1131974142 15:97925844-97925866 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1132032394 15:98449413-98449435 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1132110363 15:99098346-99098368 ATGAGGAAACTGAGTCTGGGAGG + Intronic
1132420970 15:101668193-101668215 ATGATTAAGCTTGGTGAGGAAGG - Intronic
1133093018 16:3419736-3419758 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1133468185 16:6048188-6048210 TTGTTGAAGCTGGCTCAGGAAGG + Intronic
1133819913 16:9226878-9226900 ATGGTGAAGCTGAGGCATGGAGG + Intergenic
1133831852 16:9330610-9330632 AGAAGGAAGCTGTGTCAGGATGG + Intergenic
1134038168 16:11048093-11048115 ATGAGGAAACTGAGTCAGAGAGG + Intronic
1134126476 16:11619672-11619694 CTCAGGAAGCTGAGGCAGGATGG - Intronic
1134272967 16:12750301-12750323 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1134398354 16:13886218-13886240 ATGAAGAAGCTGAGGCTTGATGG + Intergenic
1135473794 16:22755647-22755669 AGGAGGAAGCTAAGTCATGAAGG - Intergenic
1135493580 16:22931743-22931765 AAGATGAAGCTAAGTCAGATGGG - Intergenic
1135660405 16:24291720-24291742 ATGAGGAAACTGAGGCAGGAGGG - Intronic
1135766385 16:25180939-25180961 ATGATTAAGCTTGGTGAGGAAGG + Intergenic
1135800193 16:25487385-25487407 CTTATGAAGCTTAGTCTGGATGG + Intergenic
1135803241 16:25518575-25518597 CTCAGGAAGCTGAGGCAGGAGGG + Intergenic
1136050411 16:27646218-27646240 AGGATGAAGCAGAGTCCTGATGG - Intronic
1136118959 16:28116527-28116549 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1137416181 16:48282846-48282868 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1137740400 16:50765578-50765600 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138073028 16:54012041-54012063 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1138255456 16:55554731-55554753 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1138589032 16:57989632-57989654 ATGATGAAATGGACTCAGGAAGG + Intergenic
1139006287 16:62575449-62575471 AGGATGAAGAGGAGTCAGGAAGG + Intergenic
1139749827 16:69102865-69102887 ATGTTGCTGCTGAGTGAGGACGG + Intergenic
1140157061 16:72441480-72441502 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1140248761 16:73275726-73275748 ATGCTGATGCTGAATCATGAAGG + Intergenic
1140398983 16:74654641-74654663 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1140574659 16:76152573-76152595 ATGATTAAGCTTAGTGAGGACGG - Intergenic
1141304487 16:82848835-82848857 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1142607345 17:1089409-1089431 ATGAGGAAGCTGATTCAGAGCGG + Intronic
1142653379 17:1372496-1372518 ATGATGAAGCTGAGTCAGGAAGG - Intronic
1142721137 17:1776691-1776713 AAGCTGAAGCTGAGTTATGAAGG + Exonic
1142918980 17:3167885-3167907 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1143256142 17:5559445-5559467 ATGGTGTAGATGAGCCAGGATGG - Exonic
1143290985 17:5828778-5828800 ATCATGAAACTGAGTGAGCAAGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144154473 17:12485661-12485683 ATGGTGAAGCTGTGTCAGGTTGG - Intergenic
1144165655 17:12607898-12607920 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1144265689 17:13566516-13566538 ATGATTAAACTTAGTGAGGAAGG + Intronic
1144324489 17:14165677-14165699 ATGATTAAGCTTAATGAGGAAGG + Intronic
1144530780 17:16036978-16037000 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1144706858 17:17374356-17374378 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1145259088 17:21344053-21344075 AGGATGCAGCTGAGACAGGAGGG - Intergenic
1145277706 17:21444381-21444403 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145315541 17:21730259-21730281 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1145317530 17:21743950-21743972 AGGATGCAGCTGAGACAGGAGGG + Intergenic
1145713972 17:27002197-27002219 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1145981689 17:29016216-29016238 AGGAGGAAGCTGAGTCAAGGAGG + Intronic
1146106019 17:30038000-30038022 ATGATTAATCTTAGTAAGGAAGG + Intronic
1146115483 17:30133982-30134004 ATGATTAAGCTGATTGAGGAAGG - Intronic
1146578766 17:34017502-34017524 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1147372120 17:39999625-39999647 ATGATTATGCTTAGTGAGGAAGG + Intergenic
1147453116 17:40518635-40518657 ATGATGGTGAGGAGTCAGGAAGG - Intergenic
1147659165 17:42107981-42108003 GTGGTGAAGCTGAGTGAGGCTGG - Exonic
1148696238 17:49560810-49560832 ATGATTAAACTCAGTGAGGAAGG + Intergenic
1149111519 17:53036997-53037019 CTGATGATGGTGTGTCAGGAAGG - Intergenic
1149357875 17:55862452-55862474 ATGAAGAAACTGAGTCAGTTTGG + Intergenic
1149372817 17:56011937-56011959 AAGATGAAACTGAGTCATGTTGG + Intergenic
1149817817 17:59743928-59743950 ATGTTGAAGAGGAGTCATGAAGG + Intronic
1150031581 17:61742458-61742480 ATGATTAAGCTTAGTGAGCAAGG - Intronic
1150264410 17:63822907-63822929 ATGAGGAAACTGAGGCAGCAAGG + Intronic
1151284543 17:73100508-73100530 TGGATGAAGCAGAGTGAGGAAGG - Intergenic
1151410776 17:73926780-73926802 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1151585599 17:75006606-75006628 ATGATGAAGCTGAAACCAGAAGG + Intergenic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1152194197 17:78907009-78907031 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1152262427 17:79274298-79274320 ATGAGGAAACTGAGGCAGCAAGG - Intronic
1152520134 17:80851034-80851056 CTCAGGAGGCTGAGTCAGGAGGG - Intronic
1152902539 17:82951648-82951670 ATGTTTAAGCTTAGTGAGGAAGG - Intronic
1152971947 18:170409-170431 ATGATTAAGCTTAGTAAAGAAGG + Intronic
1152981462 18:281585-281607 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1153126533 18:1798656-1798678 ACGATTAAGCTGGGTGAGGAAGG + Intergenic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153292785 18:3518079-3518101 ATGATTAAGCTTAGTTAGGAAGG - Intronic
1153859682 18:9188989-9189011 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1153896346 18:9565439-9565461 ATGATTAAGCTTAGTGGGGAAGG + Intronic
1153921355 18:9793179-9793201 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1154096625 18:11422636-11422658 ATGATTAAGCTTAGTAAGAAGGG - Intergenic
1154127799 18:11708193-11708215 ATGATTAAGCTTACTGAGGAAGG - Intronic
1154249490 18:12731662-12731684 ATGATTAAGCTTATTGAGGAAGG - Intergenic
1154250605 18:12741248-12741270 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
1154341665 18:13507900-13507922 ATGATTAAACTTAGTGAGGAAGG + Intronic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155266145 18:24095799-24095821 ATGATTAAGCTTAATGAGGAAGG - Intronic
1155470221 18:26183911-26183933 ATGATGGAGCTGACTCATCAGGG - Intronic
1155511911 18:26586547-26586569 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1155661797 18:28258068-28258090 ATGATGAAAAGGAGTCAGTAAGG + Intergenic
1155686223 18:28555143-28555165 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1155694300 18:28666329-28666351 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1155862840 18:30925751-30925773 ATGCTTAGGCTGAGTCTGGAAGG + Intergenic
1155868867 18:31000422-31000444 AGCGTGAAGCTGAGTCAGTAGGG - Intronic
1156320938 18:36021589-36021611 GTGATGAAGTTTAGTGAGGAAGG + Intronic
1156406318 18:36786080-36786102 AAGGTGAAGCAGAGACAGGAAGG + Intronic
1156629195 18:38946182-38946204 ATGATGAAGCTTAGCGAGGAAGG + Intergenic
1156851978 18:41739214-41739236 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1156875950 18:42011737-42011759 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1157010225 18:43639257-43639279 ATAATGAAGCTTAGTGAGAAAGG - Intergenic
1157047816 18:44124016-44124038 ATGATGAAAATGAGTCACAAAGG + Intergenic
1157174238 18:45436760-45436782 AAGCAGAAGCTGAGTAAGGATGG + Intronic
1157354263 18:46918231-46918253 AGGAAGATGCTGAGTCAAGATGG + Intronic
1157545533 18:48543905-48543927 AAGATGAAGATAAGGCAGGAAGG - Intronic
1157960458 18:52148190-52148212 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1158137431 18:54223650-54223672 ATGATGAATCTGGGACAGGCTGG + Intronic
1158609083 18:58922596-58922618 TTGATGAAGCGGTGTCAAGATGG - Intronic
1158890779 18:61870177-61870199 ATAAAGAAGCTGTGTCGGGATGG + Intronic
1158919201 18:62170703-62170725 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1159388838 18:67761605-67761627 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1159656877 18:71040433-71040455 GTGATTAAGCTTAGTGAGGAAGG + Intergenic
1159801388 18:72904523-72904545 AAGATGAGGCAGAGACAGGAGGG + Intergenic
1160117389 18:76093493-76093515 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1160218093 18:76951773-76951795 ATGATTAAGCTTAATGAGGAAGG - Intronic
1160450505 18:78961011-78961033 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1160546470 18:79660081-79660103 ATGATTAAGCTTGGTGAGGAAGG - Intergenic
1161840594 19:6678009-6678031 ATGATGTAGCTGAGGCTGGAGGG + Exonic
1162127977 19:8509612-8509634 TTTAGGAAGCTGAGGCAGGAGGG - Intergenic
1162147293 19:8620637-8620659 AAGATGAGGATGAGGCAGGAGGG + Intergenic
1163348932 19:16763158-16763180 AGGATGAAGCTGAGTCTGCAGGG - Intronic
1164170975 19:22725008-22725030 ATGATGAATCTTGGTCAGGTGGG - Intergenic
1166392255 19:42415365-42415387 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1166557696 19:43712246-43712268 ATGATTAAGCTCAGTGAAGAAGG - Intergenic
1166580164 19:43890049-43890071 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1166734693 19:45077082-45077104 ATGGTGGAGCTGAGGCTGGAGGG + Intergenic
1167557351 19:50204535-50204557 ATGTGGAAACTGAGGCAGGAAGG - Intronic
1167626850 19:50596063-50596085 ATGATTAAGTTCAGTGAGGAAGG + Intergenic
1167854759 19:52228601-52228623 ATGCTGGAGCTGGGTCAGGGTGG + Exonic
1168652847 19:58103774-58103796 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1202634473 1_KI270706v1_random:31956-31978 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1202651407 1_KI270707v1_random:8089-8111 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1202660717 1_KI270708v1_random:67627-67649 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
924989673 2:301832-301854 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925153024 2:1629034-1629056 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
925168568 2:1736247-1736269 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925206890 2:2014621-2014643 ATTATGAATCAGAGTCAGGCAGG - Intronic
925215522 2:2092153-2092175 ATGATTAAGCTTAGTAAGGAAGG - Intronic
925360062 2:3272390-3272412 ATGATTAAGCTTAGTGAGGAAGG - Intronic
925570314 2:5303469-5303491 ATGATGGTGCAGAGCCAGGAAGG + Intergenic
925807025 2:7660675-7660697 ATGACGAGGCTGAGTCAGTCTGG + Intergenic
925854074 2:8112661-8112683 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
925871424 2:8274831-8274853 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
925954294 2:8946963-8946985 ATGATTAAGCTTAGTGACGATGG + Intronic
926111192 2:10184820-10184842 ATGGGGAAACTGAGTCAGAAAGG + Intronic
926387956 2:12356475-12356497 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
926430557 2:12781004-12781026 AGGATGAAGCTGGGGCTGGAAGG - Intergenic
926493531 2:13555426-13555448 ATGATTAAGCTTACTGAGGAAGG - Intergenic
926608410 2:14921031-14921053 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
926649441 2:15325843-15325865 ATGATTAAGCTTAGTGAGGAAGG - Intronic
926818525 2:16826612-16826634 ATGATTAAGATTAGTGAGGAAGG - Intergenic
926893104 2:17655227-17655249 ATGATGAAAATGAATGAGGATGG + Exonic
926895361 2:17681457-17681479 ATGATTAAGCTTAGTGAGGAAGG - Intronic
926916822 2:17900394-17900416 ATGATAGAGCTGAGTCTTGAAGG + Intronic
927379957 2:22467933-22467955 ATGATCAAGCTGAGACAGAGAGG - Intergenic
927396413 2:22656104-22656126 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
927448052 2:23183186-23183208 ATGATTAAGTAGAGGCAGGAAGG - Intergenic
927657325 2:24960486-24960508 ATGATTAAGCTTAGTGAGGAAGG + Intronic
927827173 2:26316951-26316973 AAGAGGAAGCTGAGGCAGCAGGG + Exonic
928046156 2:27934564-27934586 ATGATGAAGTTTAGTGAGGAAGG + Intronic
928227189 2:29460851-29460873 ATGATTAAGCTTGGTAAGGAAGG + Intronic
928282760 2:29963676-29963698 CTGATGCTGCTGAGTCAGGCAGG - Intergenic
928435396 2:31251532-31251554 ATGAAGCAACTGAGTCAGGAGGG + Intronic
928437384 2:31263656-31263678 AGGGTGAGGCTGAGCCAGGAAGG - Intronic
928571623 2:32615060-32615082 AAGATGAAGCGGAATCACGAAGG + Intronic
928589252 2:32797285-32797307 CTTAGGAAGCTGAGGCAGGAGGG - Intronic
928631240 2:33194315-33194337 ATGATTAACCTTAGTGAGGAGGG + Intronic
928657248 2:33465047-33465069 ATGATAAAGCCTAGTGAGGAAGG + Intronic
929097471 2:38277712-38277734 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
929670720 2:43875016-43875038 ATGATGAGGCTGTGGCAGGAGGG - Intronic
929804226 2:45130579-45130601 CTCATGAAGCTGAGCCAGGAGGG - Intergenic
929866812 2:45724518-45724540 ATGATGAAGCTTAGTGAGGAAGG + Intronic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
930471712 2:51824138-51824160 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
930492016 2:52086069-52086091 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
930559236 2:52939502-52939524 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
930827002 2:55704983-55705005 ATGCTGAAGCTCAGCCAGCACGG + Intergenic
930948710 2:57110275-57110297 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
931013685 2:57949724-57949746 ATGATTAAGCTTAATGAGGAAGG + Intronic
931022356 2:58062438-58062460 ATAATTAAGCTTAGTGAGGAAGG + Intronic
931050713 2:58411393-58411415 ATGATTAAGATTAGTGAGGAAGG + Intergenic
931425789 2:62169844-62169866 ATGATCAGAGTGAGTCAGGATGG - Intergenic
931907921 2:66862704-66862726 ATGCTGAAGATGAGACTGGATGG - Intergenic
931960981 2:67482591-67482613 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
932033339 2:68213252-68213274 ATGATGAAGCTTATTGAGGAAGG - Intronic
932186096 2:69697598-69697620 ATGATTAAGCTTAGTAAGCAAGG - Intronic
932243476 2:70176734-70176756 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
932469932 2:71948121-71948143 ATGATCAAGATTAGTGAGGAAGG - Intergenic
932688186 2:73891354-73891376 AAGACGAAGCAGAGTCAGGAAGG + Intergenic
933075963 2:77927021-77927043 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933171010 2:79125167-79125189 ATGATTGAGCTTAGTGAGGAAGG - Intergenic
933328380 2:80867116-80867138 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
933630131 2:84646435-84646457 ACGATTAAGCTTAGTGAGGAAGG + Intronic
933848122 2:86342283-86342305 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
933873604 2:86595532-86595554 ATGATTAAGATTAGTGAGGAAGG + Intronic
933896839 2:86818800-86818822 ATGATTAAGTTTAGTGAGGAAGG + Intronic
933906272 2:86896689-86896711 ATGATTAAGCTTCGTGAGGAAGG + Intergenic
934061668 2:88299990-88300012 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
934548312 2:95237635-95237657 ATGATCAAGCTTAGTGAGGAAGG + Intronic
934720417 2:96571422-96571444 CTGGTGATGCTGAGTCAGGCAGG - Intergenic
935289090 2:101594130-101594152 ATGATGAAGCTTAGTCAGGAAGG - Intergenic
935389195 2:102532555-102532577 ATGAGGAGGGTGAGTCTGGAGGG + Exonic
935460212 2:103322213-103322235 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
935581081 2:104756347-104756369 GTGAGGAAGCTGAGACTGGAAGG + Intergenic
935608250 2:104992566-104992588 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
935776270 2:106475068-106475090 ATGATTAAGCTTCGTGAGGAAGG - Intergenic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
935990371 2:108713740-108713762 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
936365894 2:111854993-111855015 ATGATTAAGCTTAGTGAGGAAGG - Intronic
936409573 2:112244985-112245007 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937109973 2:119358148-119358170 ATGATTAAGCTTAGTGAGGAAGG + Intronic
937159984 2:119751342-119751364 ATGATGAAGGTGTGTAAGAAAGG - Intergenic
937174047 2:119908722-119908744 ATGATTAAGTTCAGTGAGGAAGG + Intronic
937197625 2:120173788-120173810 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
937247928 2:120505529-120505551 GCGATGAAGCTGAGACAGGAAGG + Intergenic
937328294 2:121005439-121005461 ATGATGGAGCAGTGTCAGGTAGG + Intergenic
937461747 2:122094861-122094883 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
937728489 2:125196746-125196768 AAGATGATGCTGGGTTAGGATGG + Intergenic
937767049 2:125673671-125673693 ATGATTAAACTTAGTGAGGAAGG + Intergenic
937818547 2:126281155-126281177 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
937979264 2:127604604-127604626 ATGATTAAGCTTCGTGAGGAAGG - Intronic
938022461 2:127917371-127917393 GTGATGAAGGTTAGTGAGGAAGG - Intergenic
938396323 2:130951312-130951334 ATGATTCAGCTTAGTAAGGAAGG - Intronic
938441535 2:131339098-131339120 AAGATAGAGATGAGTCAGGATGG - Intronic
938562528 2:132486931-132486953 ATGATTAAGCTTAGTAAGAAAGG - Intronic
938681961 2:133701291-133701313 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
938872002 2:135487974-135487996 ATGATCATGCTTAGTGAGGAAGG - Intronic
939035545 2:137126751-137126773 ATGATTAAGCTTAGAAAGGAAGG - Intronic
939186015 2:138861590-138861612 GTGATGAAGCTTAGTGAGGAAGG - Intergenic
939285444 2:140123227-140123249 ATGATAAAGCTTAATGAGGAAGG - Intergenic
939437833 2:142201422-142201444 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
939663682 2:144922637-144922659 ATGATTAAGCTCAGCGAGGAAGG + Intergenic
939786912 2:146525972-146525994 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
939817403 2:146912608-146912630 ATAATTAAGCTCAGTGAGGAAGG + Intergenic
939886791 2:147689916-147689938 ATGATGAAGATGCATGAGGAAGG - Intergenic
940037452 2:149325760-149325782 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
940495983 2:154429205-154429227 AAGATTAAGCTTAGTGAGGAAGG + Intronic
941371302 2:164668283-164668305 ATGATCAAGTTTAGTGAGGAAGG - Intronic
941386200 2:164855568-164855590 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
941433899 2:165444542-165444564 AAGATGAAGCTTAGTGAAGATGG + Intergenic
941503740 2:166313815-166313837 ATGATTAAGCTTAGTGAGGAAGG - Intronic
941600284 2:167535101-167535123 TTGATGAAGCTAAGTCATCAAGG + Intergenic
941733036 2:168940173-168940195 ATGACTAAGCTCAGTGAGGAAGG + Intronic
941834636 2:170003164-170003186 ATAATCAAGATGAGTGAGGAAGG - Intronic
941974583 2:171389113-171389135 AAGATTAAGCTTAGTGAGGAAGG + Intronic
942058577 2:172207247-172207269 AGGATGAAGCAGAGTCAGGGAGG - Intergenic
942229338 2:173845139-173845161 ATGAGGTAGCTGAACCAGGATGG - Intergenic
942258955 2:174138181-174138203 ATGATTAAGCTTAGTGAGGAAGG - Intronic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
942614861 2:177781040-177781062 ATGATTAAGCTTAGTGAGAAAGG - Intronic
942747804 2:179255251-179255273 ATGATTAAGCTTACTCAGGAAGG + Intronic
942761695 2:179406170-179406192 ATTATGAGGCTGAGTCAGAGTGG - Intergenic
942876875 2:180811065-180811087 ATGATCATGCTTAGTGAGGAAGG + Intergenic
943012657 2:182469699-182469721 ATGATGAAGTTTAGTGAAGAAGG - Intronic
943034503 2:182725361-182725383 ATGATTAAGCTTAGTGAGGGAGG + Intronic
943087416 2:183329390-183329412 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943251687 2:185529636-185529658 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
943330888 2:186557855-186557877 ATGATTAAGCTTAGTGAGGGAGG - Intergenic
943420828 2:187667175-187667197 ATTATCAAGCTTAGTGAGGAAGG + Intergenic
943616545 2:190099225-190099247 ATGATCAAGCTTAGTGAGGAAGG - Intronic
943740815 2:191406427-191406449 ATGATTAAGCTTAGTGAGGAAGG - Intronic
943935468 2:193909797-193909819 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
943940941 2:193995503-193995525 ATGATTAAGTTTAGTCAGGAAGG + Intergenic
943957341 2:194209081-194209103 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
944201087 2:197108215-197108237 ATGAGGAAGCTGAGGCAGAGAGG - Intronic
944273967 2:197814613-197814635 ATGATTAAGCTTAGTAAGGAAGG + Intronic
944522600 2:200586953-200586975 AGGAGGAAACTGAGGCAGGAAGG + Intronic
944529589 2:200654144-200654166 ATGATTAAGCTTAGTAAGGAAGG + Intronic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
944623147 2:201539839-201539861 ATGATTAAGCTTACTGAGGAAGG + Intronic
945125561 2:206505780-206505802 ATGATGAAACTGAGGCATGGAGG + Intronic
945232045 2:207602012-207602034 ATCATGAAGCTGAGTCAGTATGG + Exonic
945561796 2:211348852-211348874 ATGATGAAGCTAAGGAAAGACGG + Intergenic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
945690911 2:213034396-213034418 ATGATGAGGCTTAGTGAGGAAGG - Intronic
946518341 2:220438089-220438111 ATAATGAGGGTGAGTCAGCAAGG + Intergenic
946713580 2:222530835-222530857 ATGATTAACCTTAGTGAGGAAGG - Intronic
946853169 2:223927769-223927791 ATGATTAAGCTTAGTGAGGAAGG - Intronic
947020709 2:225672651-225672673 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
947035472 2:225849095-225849117 ATGATTAAGCTAAGTGAGCAAGG - Intergenic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
947786322 2:232824256-232824278 ATGATTAAGCTTAGTGAGGAAGG + Intronic
948418406 2:237835390-237835412 ATGATTAAGCTTAGTGAGGAAGG + Intronic
948747164 2:240105390-240105412 ATGTTGGGGCTGGGTCAGGAGGG + Intergenic
1168828102 20:827669-827691 ATAATTAAGCTGATTCAGAAGGG - Intergenic
1169032815 20:2424756-2424778 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1169432717 20:5553494-5553516 ATGATTAAGATTAGTGAGGAAGG + Intronic
1169485212 20:6024626-6024648 ATTATTAAGCTTAGTGAGGAGGG + Intronic
1169623746 20:7539452-7539474 CTCAGGAAGCTGAGGCAGGAAGG + Intergenic
1169653903 20:7900797-7900819 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1169756709 20:9050643-9050665 ATGATGAAGCTGAGTGAGGTAGG - Intergenic
1170174327 20:13451842-13451864 ATGATTAAGGTTAGTGAGGAAGG - Intronic
1171773758 20:29347294-29347316 TTGATGAAGATGAGTGAAGATGG - Intergenic
1171815770 20:29784843-29784865 TTGATGAAGATGAGTGAAGACGG - Intergenic
1171902596 20:30871194-30871216 TTGATGAAGATGAGTGAAGATGG + Intergenic
1172337080 20:34125858-34125880 CTTAGGAGGCTGAGTCAGGAGGG + Intergenic
1172610701 20:36249725-36249747 ATGAGGAAGCAGGCTCAGGAAGG + Intronic
1173248321 20:41351143-41351165 CTGAGGAGGCTGAGGCAGGAGGG + Intronic
1173381433 20:42546624-42546646 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1173443604 20:43098342-43098364 ATGAGGAAACTGAGGCAGAAGGG - Intronic
1173707350 20:45121586-45121608 ATGATTAACCTTAGTGAGGAAGG - Intergenic
1173772514 20:45674527-45674549 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1173847375 20:46196691-46196713 ATGAGGAACCTGACTCAGCAAGG - Intronic
1173882641 20:46428547-46428569 ATGATTAAGCTTAGTGAGGGAGG + Intronic
1173942058 20:46919809-46919831 ACGATTAAGCTTAGTGAGGAAGG - Intronic
1174025696 20:47572501-47572523 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174650553 20:52121247-52121269 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1174673202 20:52327673-52327695 ATGATGACGCTTAGTGAGGGAGG + Intergenic
1174692522 20:52521750-52521772 ATGATGATGCTTAGTGAGGAAGG - Intergenic
1174745930 20:53062851-53062873 ATGACTAAGCTGAGTTGGGAAGG - Intronic
1175025563 20:55898856-55898878 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1175088363 20:56480608-56480630 ATGATTAAGCTTAGGGAGGAAGG - Intronic
1175167960 20:57059433-57059455 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175547041 20:59785054-59785076 ATGAGGAGGCTCAGGCAGGAGGG + Intronic
1175774290 20:61643313-61643335 AAGAGGTAGCTGAGTCATGAGGG - Intronic
1176134678 20:63517070-63517092 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
1176646694 21:9357731-9357753 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1176946058 21:14983126-14983148 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1177413731 21:20767768-20767790 ATTATAAAGCTTAGTGAGGAAGG - Intergenic
1177461438 21:21416055-21416077 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1177869236 21:26550444-26550466 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1178070688 21:28962713-28962735 ATGATGAAGCTTAGCAAGGAAGG + Intronic
1178519425 21:33275741-33275763 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1178967542 21:37136279-37136301 ATGATTAAGCTTCGTGAGGAAGG + Intronic
1179039991 21:37794357-37794379 ATGAGGAAACTGAGGCATGAGGG - Intronic
1179429171 21:41307543-41307565 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179965133 21:44799821-44799843 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1180113340 21:45677093-45677115 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1180319221 22:11305410-11305432 TTGATGAAGATGAGTGAAGACGG - Intergenic
1180328204 22:11451220-11451242 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1180335986 22:11577162-11577184 TTGATGAAGATGAGTGAAGATGG + Intergenic
1180366232 22:11941271-11941293 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1180417622 22:12782989-12783011 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1180461083 22:15565305-15565327 AAGATAGAGATGAGTCAGGATGG - Intergenic
1180605342 22:17054842-17054864 CTTAGGAAGCTGAGGCAGGAGGG + Intergenic
1180931094 22:19592354-19592376 CTGTGGAAGCTGAGGCAGGAGGG - Intergenic
1180932563 22:19603073-19603095 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1182182135 22:28361181-28361203 ATGATTATGCTTAGTGAGGAAGG + Intronic
1182408502 22:30159878-30159900 GTGCTGAAGCTCAGTCAGTAAGG - Intronic
1182412344 22:30197851-30197873 TTGATGAAGCTGTGTGTGGAAGG - Intergenic
1182533674 22:30983106-30983128 CTCATGAGGCTGAGGCAGGAGGG - Intergenic
1182543844 22:31061341-31061363 ATGAGGAAGCTGAGTCACACAGG + Intergenic
1182578176 22:31287838-31287860 ATGAGGAAACTGAGGCAAGAGGG - Intronic
1182734675 22:32523750-32523772 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1183666263 22:39247959-39247981 CTCAGGAGGCTGAGTCAGGAGGG + Intergenic
1183681483 22:39332876-39332898 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1183730179 22:39614158-39614180 ATGAAGAAACTGAGACAGAAGGG - Intronic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184510894 22:44932593-44932615 ATGATGAAGCTGAGGCCAGCGGG - Intronic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1185262132 22:49873217-49873239 ATGATTAAGCTTAGTGATGAAGG - Intronic
949270206 3:2207323-2207345 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949438346 3:4053046-4053068 ATGATTAAGCTTAGTGAGGAAGG - Intronic
949626436 3:5871964-5871986 ATGATTAAGTTTAGTAAGGAAGG + Intergenic
949728713 3:7081620-7081642 ATGATTAAGCTTAGTGAGGAAGG + Intronic
949826719 3:8173255-8173277 ATGATGAAGGTGAGTTTGAAGGG + Intergenic
950028536 3:9836717-9836739 AAGATAAGGCTGAGGCAGGAGGG + Intronic
950112679 3:10429704-10429726 ATGATTAAGCTTAGTGAGGAAGG + Intronic
950117183 3:10458905-10458927 AAGAGGAAACTGAGGCAGGAAGG - Intronic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950276648 3:11666942-11666964 ATGAGGAAGCGGAGTCAGGAAGG - Intronic
950632436 3:14291728-14291750 ATGATTAAGCTTAGTGAGGGAGG + Intergenic
950700312 3:14740147-14740169 ATGATTAACCTTAGTGAGGAAGG - Intronic
950716515 3:14851319-14851341 ATGAGGAAACTGAGGCAGGCAGG + Intronic
950915366 3:16639056-16639078 ATGGTGAAGCTGAGACCTGAGGG + Intronic
950928127 3:16763635-16763657 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
950957969 3:17075101-17075123 ATAATGAAGCTTACTGAGGAAGG - Intronic
950976293 3:17249300-17249322 ATGTTGAAGCTTAGTTAGGAAGG - Intronic
950988879 3:17409495-17409517 ATGATTAAGCTTAGTGAGGAAGG + Intronic
951333061 3:21388394-21388416 ATGATGAAGCTTAGTAAGGAAGG + Intergenic
951348194 3:21572121-21572143 ATTAATGAGCTGAGTCAGGATGG - Intronic
951530056 3:23690371-23690393 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951851811 3:27149804-27149826 ATGATAAAGCTTAGTGAGGAAGG + Intronic
951862405 3:27267827-27267849 ATGATGAAGCTTAGTGAGAAAGG + Intronic
952119420 3:30224176-30224198 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
952365478 3:32671119-32671141 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
952446457 3:33385493-33385515 ATGAGGGAGCTGAGCCTGGAAGG - Exonic
952574736 3:34760721-34760743 ATAATGAAGCTTAGTCTGGTGGG - Intergenic
952766440 3:36958092-36958114 ATGATAAAGATGAGTCATGAAGG - Intergenic
952809980 3:37393243-37393265 ATGATTAAGCTTAGTGAGGAGGG + Intronic
952899916 3:38103639-38103661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
952968701 3:38637196-38637218 CTGATGAACCTGGGGCAGGATGG - Intronic
953174454 3:40537165-40537187 ATGATTAAGCTTAGTGAGGAAGG + Exonic
953367232 3:42355545-42355567 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953414185 3:42706033-42706055 ATGATGGAGCTGGGTGGGGAAGG - Intronic
953436052 3:42878291-42878313 ATGATTAAGCTTAGTGAGGAAGG + Intronic
953445731 3:42964111-42964133 ATGATTAAGCTTAGTGAAGATGG + Intronic
953467107 3:43131717-43131739 ATGAGGAAACTGAGGCCGGAAGG + Intergenic
953483987 3:43277158-43277180 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
953591973 3:44266431-44266453 ATGATTAAGCTTAGTGAGGAAGG - Intronic
954137330 3:48588041-48588063 ATGAGGAAGATCAGTCAGGAGGG - Intronic
954647137 3:52138402-52138424 CTGATGGGGCTGGGTCAGGATGG + Intronic
954854558 3:53632597-53632619 ATGATTAAGCTTAGTGAGGGAGG - Intronic
954883681 3:53853626-53853648 GTGATGAGGATGAGACAGGATGG + Intronic
954944616 3:54409544-54409566 GTGATTAAGCTTAGTGAGGAAGG + Intronic
955211174 3:56942652-56942674 ATGATTAAGCTTAGTGAGGAAGG + Intronic
955459738 3:59168733-59168755 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
955668301 3:61374052-61374074 ATTAAGAAGCTGAGTCATTAGGG - Intergenic
955905837 3:63806785-63806807 ATACTGAAGCAGAGTCAGGCAGG - Intergenic
955969825 3:64427216-64427238 ATGATTAAGCTTAGTGAAGAAGG + Intronic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
956326538 3:68059366-68059388 ATGAGGAAACTGAGACAGAAAGG + Intronic
957093575 3:75756420-75756442 ATAATTAAGCTTAGTGAGGAAGG + Intronic
957126294 3:76165640-76165662 ATGATTAAGCTCAGTAAGGCAGG - Intronic
957400897 3:79712178-79712200 ATGATTAAGCTTGGTGAGGAAGG + Intronic
957499712 3:81038725-81038747 AAGATTAAGCTTAGTGAGGATGG - Intergenic
957536757 3:81515620-81515642 ATGATTAAGCTTAGTGAGAAAGG + Intronic
957572920 3:81971171-81971193 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
957647742 3:82954851-82954873 ATGATTAAGCTTAGTAAGTAGGG - Intergenic
957863711 3:85994577-85994599 ATGATGAAGCTTAGTGAGGAAGG - Intronic
957955733 3:87184761-87184783 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
957996735 3:87699408-87699430 AGGATGAAGCTTAGTGAGGAAGG + Intergenic
958452128 3:94286560-94286582 ATGATTAAGGTTAGTGAGGAAGG + Intergenic
958492956 3:94801472-94801494 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
958530066 3:95316883-95316905 ATGATTAAGCTTAGTGAGGACGG - Intergenic
958655516 3:96997386-96997408 ATGATTAAACTTAGTGAGGAAGG - Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
958933095 3:100228631-100228653 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959014333 3:101115701-101115723 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
959057708 3:101584379-101584401 TTTGGGAAGCTGAGTCAGGAGGG - Intronic
959109774 3:102108474-102108496 ATGATTAAGCTTAGTTAGAAAGG - Intronic
959165197 3:102768186-102768208 ATGATCAGGCTTAGTAAGGAAGG - Intergenic
959413099 3:106049298-106049320 ATGATTAAGCTTAGTGAGGATGG + Intergenic
959546360 3:107601335-107601357 ATGATTAAGCTTATTGAGGAAGG + Intronic
959557593 3:107739842-107739864 ATGAGGAAACTGAGGCAGAAAGG + Intronic
959608865 3:108271470-108271492 CTCAGGAAGCTGAGGCAGGAGGG + Intergenic
959616751 3:108357266-108357288 AAGATGGAGCTGGGTCTGGAGGG + Intronic
959721681 3:109497875-109497897 ATGATTAAGCTTACTGAGGAAGG - Intergenic
959773099 3:110123545-110123567 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
959784327 3:110276080-110276102 ATGATTAAGCTTAGCAAGGAAGG + Intergenic
959821140 3:110736994-110737016 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
959873540 3:111355664-111355686 ATGATGAAGCTTAGTGAGGAAGG + Intronic
959898511 3:111633047-111633069 ATAATTAAGCTTAGTGAGGAAGG - Intronic
959988389 3:112602412-112602434 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
960154599 3:114286038-114286060 ATGATTAAGCTTAGTGAAGAAGG - Intronic
960179829 3:114562639-114562661 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960242243 3:115358744-115358766 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
960549324 3:118956401-118956423 ATGATTAAGCTTAGTGAGGAAGG - Intronic
960648068 3:119912049-119912071 ATGATTAAGCTGAGCAAGGAAGG - Intronic
961092165 3:124122877-124122899 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961141960 3:124563303-124563325 AAGATGAAACTGACTCAGGAAGG - Intronic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961411596 3:126726112-126726134 ATGATTAAGCTTAGTGAGGAAGG - Intronic
961613164 3:128156925-128156947 ATGATTAAGCTTAGTGATGAAGG + Intronic
961829401 3:129615774-129615796 AGGATGCAGCAGAGTCAGGAGGG + Intergenic
962028931 3:131578534-131578556 ATGATTAAACTTAGTGAGGAAGG + Intronic
962157414 3:132962803-132962825 ATAATGAAGCTTAGTGAGGAAGG - Intergenic
962500528 3:135986637-135986659 ACCAAGAAACTGAGTCAGGAAGG + Intronic
963183823 3:142390783-142390805 ATGATTAAGCTTAGTGAAGAAGG - Intronic
963243036 3:143029690-143029712 ATGATTAAGCTTAGTTAGGAAGG + Intronic
963283952 3:143414830-143414852 ATGATTAAGCTTAGCGAGGAAGG + Intronic
963293209 3:143514985-143515007 ATGATTAAGCTTAGTGAGGAAGG - Intronic
963608786 3:147439144-147439166 ATGATTAAGCTTAGCGAGGAAGG - Intronic
963746736 3:149131731-149131753 ATGATTAAGCTTAGTGAGGAAGG + Intronic
963946495 3:151151442-151151464 ATGATTAAGCTCAGCGAGGAAGG - Intronic
964146614 3:153471704-153471726 ATGATGAAGATTAGTGAGGAAGG - Intergenic
964439951 3:156697858-156697880 ATGATTAAGCTTAGTGGGGAAGG + Intronic
964535024 3:157711412-157711434 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
964620513 3:158716168-158716190 AGGAAGAAGCTGAGTTGGGAGGG + Intronic
964823311 3:160797512-160797534 ATGATTAAGCTTAGTGAGGAAGG + Intronic
964930148 3:162009613-162009635 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
964942183 3:162172201-162172223 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
965224198 3:165966813-165966835 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
965255657 3:166406513-166406535 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
965276374 3:166688015-166688037 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
965438695 3:168685872-168685894 ATGATGAAGCTTAGTGAGAAAGG + Intergenic
965595527 3:170406932-170406954 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
966023985 3:175252623-175252645 ATGATTAAGCTTAGTAAGGAAGG + Intronic
966106114 3:176335930-176335952 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
966116309 3:176467477-176467499 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
966214310 3:177486262-177486284 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
966282562 3:178249629-178249651 ATGATTACGCTTAGTGAGGAAGG - Intergenic
966644707 3:182231522-182231544 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
966717412 3:183027371-183027393 ATGATTAAGTTTAGTGAGGAAGG + Intronic
967377350 3:188819543-188819565 ATCATAAAACTGAGTGAGGAAGG + Intronic
967710772 3:192705216-192705238 ATGATTAAACTTAGTGAGGAAGG - Intronic
967860430 3:194147399-194147421 ATGATGACGCTGAGTGCGGGTGG + Intergenic
968153616 3:196359474-196359496 ATGATGAAGCTTAGTGAGAAAGG + Intronic
968154029 3:196363497-196363519 ATGATTAAGCTTAGTGAGAAAGG + Intronic
968166553 3:196470524-196470546 AGGATGAGGCTGAGGCTGGATGG - Exonic
968166568 3:196470609-196470631 AGGATGAGGCTGAGGCTGGATGG - Exonic
968303156 3:197631220-197631242 AAGAGGAGGCTGAGTCAGGCGGG - Intergenic
969152736 4:5184146-5184168 ATAATTAAGCTTAGTGAGGAAGG - Intronic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
969639255 4:8387270-8387292 ATGAGGAAACCGAGGCAGGAAGG + Intronic
970479211 4:16456676-16456698 ATGATTTAGCTCAGTGAGGAAGG - Intergenic
970528797 4:16960865-16960887 ATGATCAAGCTTAGTGAGGAAGG + Intergenic
970737250 4:19187576-19187598 ATGATGAAGATGGATGAGGATGG + Intergenic
970751031 4:19361680-19361702 ATGATTAAGCTTAGTCAGGAAGG + Intergenic
971071179 4:23093987-23094009 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
971164214 4:24165938-24165960 ATGATGAAGCTTAATGAGAAAGG + Intergenic
971455401 4:26839624-26839646 GTGATGAAGTTGAGCCAGCAAGG - Intergenic
971588359 4:28433717-28433739 ACAATGAAGCTTAGTAAGGAAGG - Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972521421 4:39860825-39860847 TTCAGGAAGCTGAGGCAGGAGGG + Intronic
972615365 4:40693078-40693100 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
973000714 4:44945769-44945791 ATTATTAAGCTTAGTAAGGAAGG + Intergenic
973165169 4:47068428-47068450 ATGATTAAGCTTAGCCAGGAAGG - Intronic
973223944 4:47761241-47761263 ATGATTAAGTTTAGTGAGGAAGG - Intronic
973233442 4:47868976-47868998 TTTAGGAAGCTGAGGCAGGAGGG + Intronic
973364174 4:49194304-49194326 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
973901215 4:55474051-55474073 GTGATTAAGCTTAGTGAGGAAGG + Intronic
974336900 4:60559690-60559712 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
974397044 4:61350963-61350985 ATGATTAAGCTTAGTGAGGAAGG + Intronic
974613331 4:64245951-64245973 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
974816931 4:67017106-67017128 ATGATTAAGCTAAGTGAGAAAGG - Intergenic
974859300 4:67499793-67499815 ATGATTAAGCTTAGTGAGGAAGG - Intronic
975169698 4:71219138-71219160 ATGATTAAGCTTAGTGAGGAAGG + Intronic
975240727 4:72055613-72055635 ATAATTAAGCTTAGTGAGGAAGG + Intronic
975241142 4:72060754-72060776 ATGATGAAGGGGACTCAGGTGGG - Intronic
975940680 4:79641619-79641641 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
976154481 4:82127830-82127852 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
977194434 4:94042029-94042051 ATGATTTAGCTTAGTGAGGAAGG - Intergenic
977351688 4:95896600-95896622 AAGATGAAGCTGAATCAGACAGG + Intergenic
977356039 4:95948089-95948111 ATGATTAAGCTTAATGAGGAAGG - Intergenic
977568063 4:98601808-98601830 ATGATTAAGCTTAGTGAGGAAGG - Intronic
977848006 4:101789300-101789322 ATTGTGGAGCAGAGTCAGGATGG + Intronic
977887121 4:102265141-102265163 ATGATTAGGCTTAGTGAGGAGGG - Intronic
977915753 4:102590826-102590848 ATGATTAAGCTTAGTGAGGAAGG + Intronic
978083056 4:104618073-104618095 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
978102771 4:104863278-104863300 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
978212110 4:106149365-106149387 ATGATTAAGCTTAGTGAGGAAGG - Intronic
978304132 4:107303663-107303685 ATGATTAAACTTAGTGAGGAAGG - Intergenic
978523518 4:109640910-109640932 ATAATTAAGCTTAGTGAGGAAGG - Intronic
979123685 4:116937573-116937595 ATGATTATGCTTAGTGAGGAAGG - Intergenic
979198031 4:117942982-117943004 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
979345622 4:119583584-119583606 ATGAATAAGCTTAGTGAGGAAGG - Intronic
979694902 4:123602250-123602272 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
979744453 4:124193915-124193937 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
979935949 4:126695979-126696001 ATGCTGAAAGTGAGTCAGTAGGG - Intergenic
980066247 4:128191876-128191898 ATGAAGAAGCTGAGTCTGGGAGG + Intronic
980221331 4:129919783-129919805 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
980224889 4:129969966-129969988 CTCAGGAAGCTGAGGCAGGAGGG - Intergenic
980549702 4:134318622-134318644 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
980719651 4:136678230-136678252 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
980768114 4:137334976-137334998 ATGTTTAAGCTTAGTGAGGAAGG - Intergenic
981191381 4:141868837-141868859 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
981391918 4:144200967-144200989 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
981415589 4:144489042-144489064 ATGAGGAAGCTGAGGCAGAATGG + Intergenic
981575860 4:146204586-146204608 ATGATTAAGCTTAGTGAGGCAGG + Intergenic
981806633 4:148723598-148723620 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
981865605 4:149415131-149415153 ATGATGAAACTGTGACATGATGG - Intergenic
981898401 4:149832852-149832874 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
982152783 4:152480532-152480554 ATAATTAAGCTTAGTGAGGAAGG + Intronic
982367985 4:154601373-154601395 ATGATGCAACTGAGTCTAGAAGG + Intergenic
982520641 4:156412495-156412517 ATGATTAAGCTTACTGAGGAAGG - Intergenic
982575713 4:157107310-157107332 ATGATTAAGCTTAATGAGGAAGG + Intronic
982681710 4:158438914-158438936 ATGATCAAGTTTAGTGAGGAAGG + Intronic
982842030 4:160201090-160201112 ATGATTAAGCCTAGTGAGGAAGG - Intergenic
983124664 4:163935934-163935956 ATAATTAAGCTTAGTGAGGAAGG - Intronic
983145158 4:164204796-164204818 CTGATGAAGCTGAATAAGGCTGG - Intronic
983290230 4:165793445-165793467 ATGATAAAACTTAGTAAGGAAGG - Intergenic
983333129 4:166357188-166357210 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
983531450 4:168813700-168813722 CTGGTGAGGCTGAGGCAGGAGGG - Intronic
983658473 4:170107449-170107471 ATGATTCAGCTTAGTGAGGAGGG - Intergenic
983963260 4:173779541-173779563 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
984038580 4:174700580-174700602 ATGGTTAAGCTTAGTGAGGAAGG + Intronic
984083308 4:175277594-175277616 ATACTGAAGCTGCTTCAGGATGG - Intergenic
984246802 4:177284557-177284579 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
984258590 4:177416871-177416893 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984299378 4:177895348-177895370 ATGATTAAGCTTAGTGATGATGG + Intronic
984326241 4:178255219-178255241 ATGATTAATCTTAGTGAGGAAGG - Intergenic
984340969 4:178455285-178455307 AGGAAGCAGCTGAGTAAGGAAGG - Intergenic
984479138 4:180276529-180276551 ATGACGAAGCTCAGTGAGGAAGG + Intergenic
984545117 4:181092338-181092360 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984637123 4:182123374-182123396 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
984685571 4:182664554-182664576 ATGATTAAGCTTAGTGGGGAAGG + Intronic
984971737 4:185197803-185197825 ATGATTAAGCTTAGTGAGGAAGG + Intronic
985188324 4:187342913-187342935 ATGATTAAGCTTAATGAGGAGGG - Intergenic
985311092 4:188600293-188600315 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
985328340 4:188797762-188797784 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
985430261 4:189872412-189872434 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1202761489 4_GL000008v2_random:115431-115453 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
985718261 5:1475120-1475142 AGGATGAAGCAGAGTGAGGCGGG + Intronic
985900453 5:2785106-2785128 ATGATTAAGCTGAGCAAGGAAGG + Intergenic
986408418 5:7450157-7450179 ATGATTAAGCTTAGTGAGGAAGG + Intronic
986752824 5:10804864-10804886 ATGATTACGCTTAGTGAGGAAGG + Intergenic
986776456 5:11018440-11018462 ATGATTAAGCTTAGCGAGGAAGG + Intronic
987052700 5:14161359-14161381 ATGTTTGAGCTGAGTTAGGAAGG - Intronic
987266876 5:16265200-16265222 AAGATAAGGCTGAGCCAGGACGG - Intergenic
987328967 5:16838188-16838210 ATGACGCAGCTGAGTGAGGAAGG + Intronic
987454719 5:18129394-18129416 ATGATTAAGCTTGGTGAGGACGG - Intergenic
987665331 5:20931143-20931165 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
987668845 5:20982464-20982486 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
987726675 5:21709547-21709569 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
987731969 5:21785403-21785425 ATGATTAAGCTCAGTGAAGAAGG + Intronic
987791261 5:22571297-22571319 ATGATTAAGCTTAGTGAGGAAGG - Intronic
988431662 5:31126012-31126034 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
988528835 5:32009622-32009644 CTCATGAGGCTGAGGCAGGAGGG + Intronic
988757365 5:34271041-34271063 ATAATTAAGCTCAGTGAGGAAGG + Intergenic
989001071 5:36761364-36761386 ATGATTAAGCTTAGTGATGAAGG - Intergenic
989287808 5:39722525-39722547 ATGATTAAGCGTAGTGAGGAAGG - Intergenic
989324660 5:40178059-40178081 ATGATTAAGCTTATTGAGGAAGG - Intergenic
989654091 5:43725760-43725782 ATGATTAAGCTAAGTGAGGAAGG - Intergenic
989802286 5:45557985-45558007 ATGATTGAGCTTAGTGAGGAAGG + Intronic
990112124 5:52339555-52339577 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
990148630 5:52790610-52790632 ATGATAAAGCAGAGTCATGGGGG - Intronic
990481596 5:56216463-56216485 ATGATTAAGCTCAATGAGGAAGG + Intronic
990523161 5:56599372-56599394 ATGATTAAGCTTAGCGAGGAAGG - Intronic
990629826 5:57656019-57656041 ATGATGAAGTGTAGTAAGGAAGG + Intergenic
990697470 5:58436733-58436755 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
990835922 5:60019975-60019997 ATGATTAATCTTAGTGAGGAAGG - Intronic
990874605 5:60469969-60469991 ATGAATAAGCTTAGTGAGGAGGG + Intronic
990979404 5:61588354-61588376 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991188631 5:63841536-63841558 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
991651368 5:68858246-68858268 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
991729818 5:69574701-69574723 ATGATTGAGCTTAGTGAGGAAGG + Intronic
991806250 5:70429842-70429864 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
991865136 5:71053173-71053195 ATGATTGAGCTTAGTGAGGAAGG - Intronic
992202925 5:74401734-74401756 ATGGGGAAGCTGAGTCAGGGAGG - Intergenic
992216732 5:74532128-74532150 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
992271291 5:75065941-75065963 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
992361097 5:76039141-76039163 ATGATCAAGCTTGGTCAGCATGG + Intergenic
992462794 5:76977776-76977798 ATGATTAAGCTTAGTGAAGAAGG + Intronic
992922255 5:81538049-81538071 ATGATCAAGCTCAGTGAGTAAGG + Intronic
993082149 5:83314972-83314994 ATGATTAAGCTTAGTGAGGAAGG + Intronic
993124317 5:83813860-83813882 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993126368 5:83840902-83840924 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
993193926 5:84715871-84715893 ATGAACAAGATGAGGCAGGAAGG - Intergenic
993349601 5:86832330-86832352 ATGAGAAAGCTTAGTGAGGAAGG - Intergenic
993709383 5:91209107-91209129 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993805736 5:92406803-92406825 ATGATTAAGCTTAGTGAGGAGGG + Intergenic
993897851 5:93559559-93559581 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
993906434 5:93629018-93629040 ATGATTAAGCTTAGTGAGGAAGG - Intronic
994431279 5:99664710-99664732 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
994807852 5:104475251-104475273 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
994961071 5:106603490-106603512 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
994967141 5:106688595-106688617 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
994996668 5:107072452-107072474 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
995001597 5:107137842-107137864 ATGATTAAGCTCAGTAAGGAAGG - Intergenic
995133559 5:108656850-108656872 ATGATGAAGAAGACTCAGCAGGG + Intergenic
995339562 5:111042593-111042615 ATGATTAAACTTAGTGAGGAAGG - Intergenic
995431260 5:112080461-112080483 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
995505788 5:112859668-112859690 ATGATTAAGCTTAGTGAGGAAGG - Intronic
995658653 5:114455601-114455623 ATGATTAAGCTTAATGAGGAAGG + Intronic
995802131 5:116008461-116008483 ATGATTAAGTTTAGTGAGGAAGG + Intronic
995855138 5:116583939-116583961 TTGATGAAGGTGACTCAAGATGG + Intergenic
996045788 5:118872380-118872402 ATGATTAAGCTTATTGAGGAAGG - Intronic
996067329 5:119093647-119093669 ATGATTAAGTTTAGTGAGGAGGG + Intronic
996194493 5:120586856-120586878 ATGATTAAACTTAGTGAGGAGGG + Intronic
996464905 5:123788892-123788914 ATGATTAAGCCTAGTGAGGAAGG + Intergenic
996482924 5:123995904-123995926 ATGATTACGCTTAGTGAGGAAGG - Intergenic
996512497 5:124332652-124332674 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996526369 5:124484445-124484467 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
996807432 5:127472483-127472505 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
996841952 5:127856590-127856612 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
997176230 5:131780908-131780930 ATGATCAAGCGTAGTGAGGAAGG + Intronic
998719211 5:144924493-144924515 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
998831447 5:146163788-146163810 ATGATTAAGCTTAGTGAGGAAGG - Intronic
998863720 5:146473045-146473067 ATGATTAAGCTTAGTAAGGAAGG + Intronic
998882188 5:146655572-146655594 ATGAGAAAGCTGAGGCAGAAAGG + Intronic
999265451 5:150264341-150264363 ATGAGGGTGCTGAGTCATGAGGG - Intronic
999551535 5:152692788-152692810 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
999575868 5:152976024-152976046 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
999590141 5:153135995-153136017 ATGAAGAAACTGAGTCCAGAAGG - Intergenic
999882630 5:155883368-155883390 ATGATTAAGCCTAGTGAGGAAGG - Intronic
999897116 5:156046841-156046863 ATGATTAAGCTTAGCAAGGAAGG + Intronic
1000129288 5:158279890-158279912 ATTATAAAGCTTAGTCAGGAAGG + Intergenic
1000532318 5:162438527-162438549 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1000542513 5:162557843-162557865 ATGATCAAGCTTAGTCAGGAAGG - Intergenic
1000863388 5:166483869-166483891 ATGATTAAGCTTAGCAAGGAAGG - Intergenic
1000886704 5:166755886-166755908 ATGATTCAGCTTAGTGAGGAAGG + Intergenic
1000919257 5:167119100-167119122 ATGAGGAAACTGAGGCAGAAAGG - Intergenic
1001349594 5:170946904-170946926 ATTATGAAGCTGAAACAAGAAGG + Intronic
1001479770 5:172080398-172080420 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1001511685 5:172327694-172327716 CTCAGGAAGCTGAGACAGGAGGG - Intronic
1001526111 5:172430035-172430057 ATGAGGAAACTGAGTCATGGGGG - Intronic
1001655893 5:173349356-173349378 ATGATTAAGCTTAGTGAGGATGG + Intergenic
1002881744 6:1258493-1258515 ATGATGAAGTTTAGTGAGGAAGG + Intergenic
1002912189 6:1498738-1498760 CTGCTGAAGCTGAGTCATGTTGG - Intergenic
1003404027 6:5813891-5813913 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1003598746 6:7499218-7499240 ATGGTGAAGCTTGGTGAGGAAGG - Intergenic
1003706102 6:8532169-8532191 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1003822901 6:9919916-9919938 ATGATTAAACTTAGTGAGGAAGG + Intronic
1003830928 6:10010630-10010652 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1003996162 6:11541728-11541750 ATGATAAAGCTTAATGAGGAAGG - Intronic
1004437483 6:15610518-15610540 ATAATCAAGCTTAGTGAGGAAGG + Intronic
1004550352 6:16640807-16640829 ATGATTAAGCTTAGCGAGGAAGG + Intronic
1004569299 6:16829971-16829993 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1004972303 6:20924017-20924039 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1004972340 6:20924371-20924393 ATGATTAAGCTTAGTAAGGAAGG + Intronic
1005790749 6:29297167-29297189 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1006018741 6:31104051-31104073 TTGGGGAAGCTGAGGCAGGAGGG - Intergenic
1006254115 6:32815750-32815772 ATAATGTAGGTAAGTCAGGAAGG + Intronic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1006875684 6:37293684-37293706 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1006959639 6:37915428-37915450 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1007017754 6:38486397-38486419 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1007651021 6:43421859-43421881 ATGATCAAACTTAGTGAGGAAGG + Intergenic
1008255030 6:49287891-49287913 ATGATAAAGCTTAGTGAGGAAGG - Intergenic
1008299086 6:49812168-49812190 ATGAGTAAGCTTAGTGAGGAAGG - Intergenic
1008622520 6:53285102-53285124 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1008805662 6:55424284-55424306 ATGATTATGCTTAGTAAGGAAGG - Intergenic
1008916853 6:56797420-56797442 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1009344984 6:62602987-62603009 ATGTTGGAGCTGAGTTATGAAGG - Intergenic
1009461082 6:63914274-63914296 ATGATGAAGTTTAGTGAGGAAGG + Intronic
1009590035 6:65656306-65656328 ATGATTATGCTTAGTGAGGAAGG + Intronic
1009960790 6:70518026-70518048 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1009963313 6:70551275-70551297 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1010724578 6:79318809-79318831 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1010798327 6:80144513-80144535 TTGATGAAGGTGAATCGGGAGGG + Intronic
1011019803 6:82799822-82799844 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1011069804 6:83367923-83367945 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1011115682 6:83888759-83888781 ACGATTAAGCTTAGTGAGGAAGG + Intronic
1011218048 6:85026236-85026258 ATGATTAAGCTTAGAGAGGAAGG + Intergenic
1011856504 6:91699505-91699527 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1012012745 6:93810896-93810918 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1012109048 6:95203110-95203132 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1012284482 6:97372315-97372337 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1012287661 6:97412675-97412697 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1012564906 6:100636575-100636597 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1012836712 6:104278780-104278802 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1012918455 6:105196387-105196409 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1013261271 6:108445480-108445502 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1013347378 6:109274819-109274841 ATGATTAAGCTTAGCAAGGAAGG - Intergenic
1013922780 6:115428798-115428820 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1014262457 6:119235234-119235256 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1014775157 6:125500368-125500390 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1014975539 6:127877407-127877429 ATGATTAAGCTTAGTGTGGAAGG - Intronic
1015009967 6:128333858-128333880 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1015144858 6:129974170-129974192 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1015259586 6:131221023-131221045 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1015263228 6:131262349-131262371 ATCATAAACCTGAGTAAGGAAGG + Intronic
1015304196 6:131688402-131688424 ATGATTAAGCTTAATGAGGAAGG + Intronic
1015337035 6:132051178-132051200 ATGATTAAGCTAAGTGAGGAAGG + Intergenic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015640744 6:135328731-135328753 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1015939744 6:138436176-138436198 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016426464 6:143941436-143941458 ATGATGGAAATGAGGCAGGATGG + Exonic
1016490864 6:144600274-144600296 ATGATTAAGCTTAGCAAGGAAGG + Intronic
1016794079 6:148099152-148099174 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1016836398 6:148481476-148481498 ATGATTAAGCTTAGTGAGGAGGG - Intronic
1016848021 6:148588190-148588212 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016867409 6:148781118-148781140 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1016903284 6:149123328-149123350 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1016931573 6:149415879-149415901 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1016989388 6:149918837-149918859 GTGAGGAAGAGGAGTCAGGAGGG + Intronic
1016998638 6:149979255-149979277 GTGAGGAAGAGGAGTCAGGAGGG - Intergenic
1016999752 6:149988555-149988577 GTGAGGAAGAAGAGTCAGGAGGG + Intergenic
1017006864 6:150033719-150033741 GTGAGGAAGAAGAGTCAGGAGGG - Intergenic
1017011253 6:150065172-150065194 GTGAGGAAGAGGAGTCAGGAGGG + Intronic
1017239315 6:152149280-152149302 TTGAGGAAGCTGAGGCAAGAAGG + Intronic
1017385003 6:153873217-153873239 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1017456135 6:154603285-154603307 GAGAAGAAGCTAAGTCAGGAAGG - Intergenic
1017461017 6:154650499-154650521 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1017734692 6:157350623-157350645 ATGGTTAAGCTCAGTGAGGAAGG + Intergenic
1017799585 6:157881495-157881517 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1018224173 6:161611787-161611809 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1018271439 6:162082644-162082666 ATGATTGAGCTCAGTGAGGAAGG - Intronic
1018294764 6:162333776-162333798 ATGATAAAGCTCAGTGAGGAAGG + Intronic
1018599228 6:165521402-165521424 ATAATTAAGCTTAGTGAGGAAGG + Intronic
1019629213 7:2037915-2037937 AGGATTAAGCTTAGTGAGGAAGG + Intronic
1019821984 7:3251016-3251038 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1019895745 7:3981469-3981491 ATGATGAAGCTTAGTAAGGAAGG + Intronic
1020090893 7:5340087-5340109 ATGATTAAACTTAGTGAGGAAGG + Intronic
1020423824 7:8040998-8041020 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020596857 7:10217507-10217529 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1020664563 7:11023936-11023958 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1020709578 7:11590198-11590220 ATGAAGAGGTTGAGTCAAGAAGG + Intronic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1021132781 7:16931365-16931387 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1021267960 7:18548002-18548024 ATGATTAAGCTGAGTTAGGAAGG - Intronic
1021530512 7:21639452-21639474 ATTATGAAGGTGACTCTGGAGGG - Intronic
1021934091 7:25613186-25613208 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1022063269 7:26822981-26823003 ATGATTAAGCTTAGGGAGGAAGG + Intronic
1022066720 7:26865935-26865957 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022144995 7:27528334-27528356 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1022197171 7:28080517-28080539 AGGATTAAGCTTAGTGAGGAAGG - Intronic
1022548879 7:31217504-31217526 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1023026095 7:36051107-36051129 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023710251 7:42985077-42985099 ATGATGAAGTTTAGTGAGAAAGG - Intergenic
1023724380 7:43127077-43127099 ATGATCAAGCTTAGTGAGGACGG + Intronic
1023739113 7:43262422-43262444 ATGATGAAACTGAGGCTGCAGGG + Intronic
1023773233 7:43579144-43579166 ATGGTTAAGCTTAGTGAGGAAGG - Intergenic
1024133320 7:46379623-46379645 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1024250196 7:47500642-47500664 ATGAAGAAGCTGAGTTCAGAGGG + Intronic
1024549327 7:50548301-50548323 ATGATTCAGCTGAGTGAGGAAGG + Intronic
1024786131 7:52910400-52910422 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1025195928 7:56933396-56933418 ATGATTAAGCTCAGCGAGGAAGG + Intergenic
1025676020 7:63643540-63643562 ATGATTAAGCTCAGCGAGGAAGG - Intergenic
1026104155 7:67407864-67407886 ATGAGGAAGGGGAGACAGGAGGG - Intergenic
1026256103 7:68713213-68713235 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1026415349 7:70174018-70174040 ATGATTTAGCTTAGTAAGGAAGG + Intronic
1026507741 7:71000206-71000228 ATGATTAAGTTTAGTGAGGAAGG + Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1026706831 7:72701369-72701391 CTGAGGATGCTGAGTCAGGAGGG - Intronic
1027006055 7:74693951-74693973 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1027289735 7:76693075-76693097 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027294178 7:76750049-76750071 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1027379256 7:77588202-77588224 ATGATTAAGCTTAGTAAAGAAGG - Intronic
1027490320 7:78815940-78815962 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1027512065 7:79095467-79095489 ATGATTAGGCTTAGTGAGGAAGG - Intronic
1027623128 7:80517484-80517506 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1028300110 7:89188514-89188536 ATTATTAAGCTTAGTCAGGAAGG + Intronic
1028408605 7:90503482-90503504 ATGATTAAACTTAGTGAGGAAGG - Intronic
1028455263 7:91031536-91031558 ATAATGAACATGATTCAGGATGG + Intronic
1028578205 7:92377114-92377136 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1028660951 7:93274183-93274205 ATGATTAAGCTTAGTGAAGATGG + Intronic
1028741931 7:94285315-94285337 ATGAAGAAGGTGTTTCAGGAAGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1029674181 7:102055758-102055780 ATGATTAAGCTCAGTGAGAAAGG + Intronic
1030022510 7:105289820-105289842 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1030136859 7:106260629-106260651 ATGATTAAGTTTAGTGAGGAAGG - Intronic
1030151097 7:106405956-106405978 ATGATTCAGCTTAGTGAGGAAGG - Intergenic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030387330 7:108880223-108880245 ATAATTAAGCTGAGTGAGGAAGG + Intergenic
1030479111 7:110080021-110080043 ATGATGAAATTTAGTGAGGAAGG - Intergenic
1030504071 7:110397800-110397822 ATCATGAGATTGAGTCAGGAAGG + Intergenic
1030505104 7:110411751-110411773 ATAATTAAGCTTAGTAAGGAAGG - Intergenic
1030527835 7:110674762-110674784 ATCATGAAGATGAGTTTGGAAGG - Intronic
1030955107 7:115843024-115843046 ATGAAGAACATGAGTCAGGAAGG - Intergenic
1030992982 7:116323691-116323713 ATGATGAAGCTTAGTGAAGAAGG + Intronic
1031281740 7:119811572-119811594 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1031851551 7:126870444-126870466 AAGATGAAGCTTAATGAGGAAGG - Intronic
1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG + Intronic
1032180868 7:129676344-129676366 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1032622360 7:133548959-133548981 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1032701616 7:134385326-134385348 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1032730366 7:134636195-134636217 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1032769025 7:135029745-135029767 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1032778899 7:135146033-135146055 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1033080558 7:138293036-138293058 ATGATTAAACTTAGTGAGGAAGG - Intergenic
1033112484 7:138593558-138593580 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1033241608 7:139684392-139684414 ATGATTGAGCTTAGTGAGGAAGG + Intronic
1033352625 7:140573920-140573942 ACTAGGAAGCTGAGTCGGGATGG - Exonic
1033386496 7:140881663-140881685 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1033388440 7:140902509-140902531 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1033393870 7:140955627-140955649 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1033675455 7:143537163-143537185 ATTAAGAAGCTGGGTAAGGATGG - Intergenic
1033696382 7:143792275-143792297 ATTAAGAAGCTGGGTAAGGATGG + Intergenic
1034316805 7:150140784-150140806 TTGATTATGCTGAGTGAGGAAGG + Intergenic
1034361653 7:150504948-150504970 ATGATGAAGCTTAGTGGGGCAGG + Intergenic
1034469455 7:151247717-151247739 AGGCTGGAGCTGAGTCAGTAGGG - Intronic
1034533698 7:151713685-151713707 CTCAGGAAGCTGAGGCAGGAGGG - Intronic
1034743314 7:153498368-153498390 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034743319 7:153498424-153498446 ATGATAAAGCTTAGTGAGGAAGG + Intergenic
1034790056 7:153959900-153959922 ATGATTATGCTGAGTGAGGAAGG - Intronic
1035167096 7:156997939-156997961 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1035637416 8:1156877-1156899 ATGAGGAGGCTGACTCAGGAAGG + Intergenic
1036735688 8:11313507-11313529 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1037145908 8:15572629-15572651 ATGATTAAACTTAGTGAGGAAGG - Intronic
1037218530 8:16487801-16487823 ATGATTAAGCTTAGTGAGAAAGG - Intronic
1037263390 8:17033175-17033197 ATGATTAAGCTTAATGAGGAAGG + Intronic
1037447676 8:18983459-18983481 ATGATTAAGCTTAGTGAGAAGGG - Intronic
1037853297 8:22350486-22350508 CTCAGGAGGCTGAGTCAGGAGGG + Intronic
1038025640 8:23587113-23587135 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1038463851 8:27741848-27741870 ATAAGAAAGCAGAGTCAGGATGG + Intronic
1038599602 8:28926673-28926695 CTTAGGAAGCTGAGGCAGGAGGG - Intronic
1038650347 8:29397241-29397263 ATGATGAAGTTGAGTATTGAAGG - Intergenic
1039076781 8:33697621-33697643 ATGATTAGGCTTAGTAAGGAAGG - Intergenic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1039381980 8:37094005-37094027 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1039556198 8:38476980-38477002 ATGATTGAGCTTAGTGAGGAAGG + Intergenic
1039983866 8:42431105-42431127 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1040425624 8:47282817-47282839 ATGATTAAGCTTAGGTAGGAAGG - Intronic
1040833101 8:51699655-51699677 ATGATTATGCTTAGTGAGGAAGG - Intronic
1041404084 8:57478268-57478290 ATGATTAGGCTTAGTAAGGAAGG + Intergenic
1041475994 8:58266556-58266578 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
1041646934 8:60262608-60262630 CTCAGGAAGCTGAGGCAGGAGGG + Intronic
1041822295 8:62050772-62050794 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1041862266 8:62528115-62528137 GTGATGAGGCTGTGTCAGCATGG + Intronic
1042045525 8:64646988-64647010 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1042419401 8:68567885-68567907 ATGATTTAGCTTAGTGAGGAAGG - Intronic
1042441010 8:68826609-68826631 ATGATTAAGCTCGGTGAGGAAGG - Intergenic
1042548029 8:69968219-69968241 ATGATTAAGCTTAATGAGGAAGG + Intergenic
1042785813 8:72545721-72545743 AGGATTAAGCTTAGTGAGGAAGG + Intronic
1042795464 8:72658108-72658130 ATGATTAAGCTTAGTAAGAAAGG + Intronic
1042851768 8:73223880-73223902 ATTATTAAGCTTAGTGAGGAAGG - Intergenic
1042882397 8:73508216-73508238 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1043099024 8:76016341-76016363 ATGATTAAGCTGAGTGATGAAGG + Intergenic
1043598402 8:81911591-81911613 CTGATCAGGATGAGTCAGGATGG + Intergenic
1043862736 8:85339607-85339629 ATGATTAAGCTCAGTGAAGAAGG + Intronic
1043990867 8:86752444-86752466 ATGATTAAGCTCTGTAAGGAAGG - Intergenic
1044030876 8:87235360-87235382 ATGATTAACCTGAGTAAGGAAGG - Intronic
1044044121 8:87409075-87409097 ATGATTAAGCTTAATGAGGAAGG + Intronic
1044089770 8:87984839-87984861 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1044287861 8:90430489-90430511 ATGATGAAGCTTAGAGAGAAAGG + Intergenic
1044668996 8:94659592-94659614 ATGATTAAGCTTAGTCAGGAAGG + Intronic
1045038669 8:98199343-98199365 ACGATTAAGCTTAGTGAGGAAGG - Intronic
1045073155 8:98532164-98532186 ATGATTAAACTTAGTGAGGAAGG - Intronic
1045121182 8:99036975-99036997 ATGAAGAATCTGAGACATGAAGG - Intronic
1045129527 8:99133557-99133579 ATGATTAAGCTTAGTGAAGAAGG - Intronic
1045158320 8:99505339-99505361 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1045188987 8:99864963-99864985 AGGGTGAAGCAGAGTCAAGAAGG - Intronic
1045232925 8:100322650-100322672 ATGATTAAGCTTAATGAGGAAGG - Intronic
1045563523 8:103289829-103289851 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045728611 8:105206011-105206033 ATGATTAAGCTTAGGAAGGAAGG - Intronic
1045889586 8:107139109-107139131 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1045948342 8:107823383-107823405 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1046316780 8:112513262-112513284 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1046545499 8:115644707-115644729 ATGATTATGCTTAGTGAGGAAGG - Intronic
1046571739 8:115974800-115974822 ATGATTAAGCTTAATGAGGAGGG - Intergenic
1046743822 8:117855998-117856020 ATGATTAAGCTTAGTGAAGAAGG + Intronic
1046744003 8:117857590-117857612 TTCAGGAAGCTGAGGCAGGAGGG + Intronic
1047009882 8:120660730-120660752 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1047400663 8:124543931-124543953 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1047489304 8:125361537-125361559 ATGAGGAAACTGAGGCAGAAAGG - Intronic
1047549848 8:125858859-125858881 ATGAGGAAACTGAGGCAGAAAGG + Intergenic
1047560415 8:125981648-125981670 ATGATTAAGCTTAGTGAGAAAGG + Intergenic
1047630743 8:126705127-126705149 ATGATTAAGTTTAGTGAGGAAGG - Intergenic
1047703642 8:127475152-127475174 ATGATTAAGCTTAGTAAGTATGG + Intergenic
1047794933 8:128245534-128245556 ATGATTAAGCTTAGTGAGGAGGG - Intergenic
1047897247 8:129380437-129380459 ATGATTAAGCTTAGAAAGGAAGG + Intergenic
1048375922 8:133822332-133822354 AGGCTGAACCTGGGTCAGGAAGG - Intergenic
1048798708 8:138176019-138176041 ATAAGGAAGCTGAGACTGGATGG + Intronic
1048824319 8:138409097-138409119 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1048902484 8:139052094-139052116 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1049413603 8:142484822-142484844 ATGAGGATGCTGAGGCAGAAGGG - Intronic
1049629102 8:143642559-143642581 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1049641156 8:143716594-143716616 ATGAGGAAACTGAGGCACGAAGG - Intronic
1049739481 8:144230473-144230495 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1050349578 9:4727777-4727799 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050383772 9:5061810-5061832 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1050437296 9:5624632-5624654 ATGATTAAACTAAGTGAGGAAGG - Intergenic
1050565093 9:6873819-6873841 ATGATTTAGCTTAGTAAGGAGGG - Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1050787344 9:9422205-9422227 ATGAGAAAGCTGAGACACGAAGG + Intronic
1051064420 9:13085183-13085205 ATGATTAGGCTGAGTGAGGAAGG + Intergenic
1051085008 9:13338284-13338306 ATGATTAAGCTTAGAGAGGAAGG - Intergenic
1051123770 9:13780530-13780552 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
1051298258 9:15619244-15619266 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1051432046 9:16989325-16989347 ATGATGAAGAGGAATGAGGAAGG - Intergenic
1051601678 9:18881290-18881312 ATGATTAAGCTTAGTGGGGAAGG - Intronic
1051721638 9:20043111-20043133 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1051852987 9:21530514-21530536 ATGATTAAGCTTAATGAGGAAGG - Intergenic
1052186613 9:25604539-25604561 AAGATTAAGCTTAGTGAGGAAGG + Intergenic
1053225115 9:36348100-36348122 ATGATTAAGCTTAGTAAGAAAGG + Intronic
1053250341 9:36568924-36568946 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1053296494 9:36918180-36918202 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1053465614 9:38305922-38305944 ATGATCAAGCTTAGTGAGGAAGG - Intergenic
1053575094 9:39351539-39351561 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053578955 9:39383112-39383134 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053839600 9:42179474-42179496 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1053843467 9:42211187-42211209 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054096659 9:60910222-60910244 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054100538 9:60941916-60941938 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054118062 9:61185848-61185870 ATGATTAAGGTGAGTGAGGAAGG + Intergenic
1054121934 9:61217541-61217563 ATGATTGAGCTGAGTGAGGAAGG - Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054585808 9:66964970-66964992 ATGATTGAGCTGAGTGAGGAAGG + Intergenic
1054589693 9:66996716-66996738 ATGATTAAGGTGAGTGAGGAAGG - Intergenic
1054795784 9:69300657-69300679 AAAATGAAGCTTAGTGAGGAAGG - Intergenic
1054839431 9:69720116-69720138 ATGATTAAGCTAAGTGAGGAAGG + Intronic
1054994516 9:71370277-71370299 ATAATTAAGCTTAGTGAGGATGG + Intronic
1055150690 9:72995406-72995428 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1055297094 9:74844821-74844843 ATAATTAAGCTTAGTGAGGAAGG - Intronic
1055434637 9:76280417-76280439 TTGATTAAGCTTAGTGAGGAAGG + Intronic
1055557162 9:77486570-77486592 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1055873965 9:80920389-80920411 ATGATTAAGCTTAGTAAAGAAGG - Intergenic
1056076174 9:83043033-83043055 ATGATGACCCTGAGTTAGCACGG + Intronic
1056606832 9:88092927-88092949 AGGAGGAAGCTGGCTCAGGAAGG + Intergenic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056959604 9:91111437-91111459 ATGATTAAGCTTAGTGAGTAAGG - Intergenic
1056979265 9:91293268-91293290 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1057287353 9:93768741-93768763 ATCATTAAGCTTAGTGAGGAAGG - Intergenic
1057314346 9:93958993-93959015 AGGAGGAAGCTAAGTCTGGAAGG + Intergenic
1057370578 9:94469153-94469175 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1057373072 9:94491483-94491505 ATGGGGAGGCTGAGGCAGGAGGG + Intergenic
1057398272 9:94699897-94699919 AGGATGAAGCTGAGGCAGAGAGG - Intergenic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1057539007 9:95947101-95947123 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1057823695 9:98354938-98354960 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1058348764 9:103996713-103996735 ATGATTAAGCTTATTGAGGATGG - Intergenic
1058628130 9:106957113-106957135 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059088341 9:111329112-111329134 AGGCTGAAGCTGAGACAGGGAGG + Intergenic
1059092984 9:111381139-111381161 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1059158128 9:112007849-112007871 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1059290087 9:113215217-113215239 ATGATTAAGCTTTGTGAGGAAGG - Intronic
1059384902 9:113956993-113957015 ATGAAGAAACTGAGTCACAAAGG + Intronic
1059558912 9:115311931-115311953 ATGATTAAACTCAGTGAGGAAGG + Intronic
1059711862 9:116875114-116875136 ATGATTAAGTTTAGTGAGGAAGG + Intronic
1059917506 9:119119761-119119783 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1060014312 9:120073348-120073370 AAGAGAAAGCTGAGGCAGGAAGG + Intergenic
1060066465 9:120505534-120505556 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1060202124 9:121657367-121657389 ATGATGAGGGTGGGTCAGGAAGG - Intronic
1060419928 9:123461125-123461147 ATGAAGAAGGTGAGGAAGGAAGG - Intronic
1060843963 9:126819723-126819745 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1060990995 9:127848998-127849020 ATGACCAGGATGAGTCAGGATGG - Intronic
1061121500 9:128645729-128645751 ATGATTAAGCTTAGTGAGGAGGG + Intronic
1061426277 9:130500375-130500397 GTGGTGGAGCTGAGTCCGGAGGG + Intronic
1061490702 9:130942368-130942390 ATGAGGAAACTGATTCAGAAAGG + Intergenic
1061642650 9:131971387-131971409 ATGAGGCAGCGGAGCCAGGAGGG + Intronic
1203483861 Un_GL000224v1:33295-33317 ATAATTAAGCTTAGTGAGGAAGG - Intergenic
1203367448 Un_KI270442v1:271159-271181 TTGATGAAGATGAGTGAAGACGG - Intergenic
1203708833 Un_KI270742v1:77266-77288 ATAATTAAGCTTAGTGAGGAAGG + Intergenic
1203542260 Un_KI270743v1:100308-100330 ATAATTAAGCTCAGTGAGGAAGG - Intergenic
1186437919 X:9559202-9559224 GAGACGAAGCTGAGACAGGAAGG - Intronic
1186969852 X:14829957-14829979 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1187026669 X:15442499-15442521 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1187515956 X:19970386-19970408 ATGAGGAAGCTGAGGCACAAAGG - Intergenic
1187516629 X:19977252-19977274 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1187524358 X:20040492-20040514 ATGATTGAGCTCAGTGAGGAAGG - Intronic
1187662912 X:21570600-21570622 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1187814933 X:23221250-23221272 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1187908787 X:24091380-24091402 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1188062998 X:25623975-25623997 ATGATGGAGATGAATAAGGAGGG - Intergenic
1188231091 X:27664103-27664125 ATGATCAAACTTAGTGAGGAAGG + Intronic
1188278859 X:28238072-28238094 ATGATTAAGCTTAGTGAAGAAGG - Intergenic
1188448232 X:30280125-30280147 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1188591418 X:31840994-31841016 ATGATTAAGCTTGGTTAGGAAGG + Intronic
1188822111 X:34788279-34788301 ATGATTAAGCTTAGTAAGGAAGG - Intergenic
1188932235 X:36125870-36125892 ATGATGACACTGAGGGAGGAAGG - Intronic
1189014552 X:37083290-37083312 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
1189174577 X:38942806-38942828 ATTATTAAGCTTAGTGAGGAAGG + Intergenic
1189290544 X:39882331-39882353 AGGATGAAGCAGAGTGGGGAGGG + Intergenic
1189708638 X:43785607-43785629 ATGATTAAGCTTAGTGAGGAAGG - Intronic
1189788029 X:44577193-44577215 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1189827790 X:44937768-44937790 ATGATTAAGCTTAGTGAGGAAGG + Intronic
1189830240 X:44965404-44965426 ATCATTAAGCTTAGTGAGGAAGG - Intronic
1190324652 X:49199389-49199411 ATGGTGAAGGTGAGTCATAACGG + Intronic
1190460801 X:50671885-50671907 ATGCTTAAGCTTAGTGAGGAAGG - Intronic
1190715679 X:53101267-53101289 ATGATTAAGCTTTGTGAGGAAGG - Intergenic
1191731757 X:64343807-64343829 GTGAGGAAGCTGAGGCAGAAAGG + Intronic
1191832194 X:65428013-65428035 TTGATGAAGCTTAGTCTGGCTGG + Intronic
1191957757 X:66664729-66664751 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1192084593 X:68083684-68083706 ATGATTAAGCTTAGTTAGGAAGG - Intronic
1192091681 X:68165298-68165320 ATGATTAAGCTTAATGAGGAAGG - Intronic
1192388635 X:70700689-70700711 ATGATTAAGCTTGGTGAGGAAGG + Intronic
1192754541 X:74033647-74033669 ATGATTAAACTTAGTGAGGAAGG + Intergenic
1193214625 X:78849034-78849056 ATGCTAAAGCTGAGTCTAGAGGG + Intergenic
1193551684 X:82900947-82900969 CTGATGAAGCTTAGTTTGGATGG - Intergenic
1193675580 X:84448062-84448084 TGGATGAAGCTGAGCCAGGAAGG - Intronic
1193867256 X:86749320-86749342 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1193971277 X:88057009-88057031 ATGATTAAGCTTTGTGAGGAAGG + Intergenic
1194364727 X:93000843-93000865 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1194588637 X:95769492-95769514 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194591241 X:95802520-95802542 ATGATTAAGCTTAGTGAAGAAGG + Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1194915900 X:99708281-99708303 AGGGTGAAGCTGAGGCAGGGAGG - Intergenic
1195338748 X:103883608-103883630 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1195582114 X:106517081-106517103 GTGATGGAGCTAAGTGAGGAGGG + Intergenic
1195949366 X:110251330-110251352 ATGAGCAAGCTGAGTCTTGAAGG + Intronic
1195987907 X:110651206-110651228 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
1196029342 X:111078713-111078735 ATGATTAAGCTTAGTGAGAAAGG + Intronic
1196260351 X:113572017-113572039 ATGATTAAGCTTAGTGAGAAAGG - Intergenic
1197088105 X:122503157-122503179 ATGATGAAACTGAGACAGAGTGG - Intergenic
1197114065 X:122811182-122811204 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1197129334 X:122986612-122986634 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1197456359 X:126680699-126680721 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198034622 X:132788587-132788609 ATGATTAAACTTAGTGAGGAAGG + Intronic
1198199699 X:134403131-134403153 ATTATTAAGCTTAGTGAGGAAGG + Intronic
1198323126 X:135539646-135539668 ATGATTAAACTTAGTGAGGAAGG - Intronic
1198542915 X:137659307-137659329 ATGATTAAGCTTAGTGAGGAAGG + Intergenic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1198621341 X:138514108-138514130 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1198690349 X:139276623-139276645 ATGATTAAGCTTAGTGAGGAAGG - Intergenic
1199100577 X:143794810-143794832 ATGATGATGCTGAGGCAAAATGG + Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199260182 X:145764061-145764083 ATGATTAAGCTTAGGGAGGAAGG + Intergenic
1199343776 X:146714348-146714370 ATGGTTAAGCTTAGTGAGGAAGG + Intergenic
1199916829 X:152351752-152351774 ATGATTAAGCTTAGTAAGGAAGG - Intronic
1199979638 X:152913894-152913916 ATGATGAAACTGAGGCAGCTCGG + Intergenic
1200013786 X:153142754-153142776 ATTATTAAGCTCAGTGAGGAGGG + Intergenic
1200025815 X:153257201-153257223 ATTATTAAGCTCAGTGAGGAGGG - Intergenic
1200799327 Y:7371504-7371526 TTTAAGAAGCTGAGGCAGGAGGG - Intergenic