ID: 1142656872

View in Genome Browser
Species Human (GRCh38)
Location 17:1400192-1400214
Sequence GCGCCGCCATTTTTGCTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142656872_1142656880 28 Left 1142656872 17:1400192-1400214 CCGGGCAGCAAAAATGGCGGCGC 0: 1
1: 0
2: 1
3: 13
4: 79
Right 1142656880 17:1400243-1400265 CGGACAACTGCTCAGCTCTATGG 0: 2
1: 0
2: 1
3: 4
4: 83
1142656872_1142656877 8 Left 1142656872 17:1400192-1400214 CCGGGCAGCAAAAATGGCGGCGC 0: 1
1: 0
2: 1
3: 13
4: 79
Right 1142656877 17:1400223-1400245 GGGACTTCCGCCTGCGCACGCGG 0: 1
1: 1
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142656872 Original CRISPR GCGCCGCCATTTTTGCTGCC CGG (reversed) Exonic