ID: 1142656878

View in Genome Browser
Species Human (GRCh38)
Location 17:1400230-1400252
Sequence CAGTTGTCCGCGTGCGCAGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 2, 1: 0, 2: 0, 3: 2, 4: 30}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142656878_1142656892 24 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656892 17:1400277-1400299 TGGCAACTGGCGCGGGGGGCGGG 0: 1
1: 0
2: 0
3: 10
4: 201
1142656878_1142656887 19 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656887 17:1400272-1400294 CTCCCTGGCAACTGGCGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 102
1142656878_1142656884 16 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656884 17:1400269-1400291 CCGCTCCCTGGCAACTGGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 96
1142656878_1142656885 17 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656885 17:1400270-1400292 CGCTCCCTGGCAACTGGCGCGGG 0: 1
1: 0
2: 0
3: 7
4: 113
1142656878_1142656891 23 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656891 17:1400276-1400298 CTGGCAACTGGCGCGGGGGGCGG 0: 1
1: 0
2: 0
3: 18
4: 236
1142656878_1142656881 4 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656881 17:1400257-1400279 GCTCTATGGCAACCGCTCCCTGG 0: 2
1: 0
2: 1
3: 7
4: 70
1142656878_1142656893 30 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656893 17:1400283-1400305 CTGGCGCGGGGGGCGGGTCCTGG 0: 1
1: 0
2: 5
3: 50
4: 533
1142656878_1142656888 20 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656888 17:1400273-1400295 TCCCTGGCAACTGGCGCGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 91
1142656878_1142656886 18 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656886 17:1400271-1400293 GCTCCCTGGCAACTGGCGCGGGG 0: 1
1: 0
2: 1
3: 9
4: 96
1142656878_1142656882 11 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656882 17:1400264-1400286 GGCAACCGCTCCCTGGCAACTGG 0: 1
1: 0
2: 1
3: 9
4: 98
1142656878_1142656880 -10 Left 1142656878 17:1400230-1400252 CCGCCTGCGCACGCGGACAACTG 0: 2
1: 0
2: 0
3: 2
4: 30
Right 1142656880 17:1400243-1400265 CGGACAACTGCTCAGCTCTATGG 0: 2
1: 0
2: 1
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142656878 Original CRISPR CAGTTGTCCGCGTGCGCAGG CGG (reversed) Exonic
903524211 1:23980455-23980477 CAGGCGTCCGCCTGCGCATGCGG + Intronic
903524214 1:23980462-23980484 CAGCCCTCCGCATGCGCAGGCGG - Intronic
903867584 1:26410553-26410575 CAGTTGTGCGTGTGGGGAGGGGG + Intergenic
917098296 1:171421858-171421880 CAGTCCTCCCAGTGCGCAGGTGG + Intergenic
922496440 1:226062028-226062050 CACTTGGCCGAGCGCGCAGGCGG + Intronic
1070676431 10:78414912-78414934 CAGTTGTCCCTGTGTGCTGGGGG + Intergenic
1077118352 11:895561-895583 CAGTTGTCCGCATGCCCAGAGGG - Intronic
1079451229 11:20601371-20601393 CAGTAGCCCGCGGGCGCAGGCGG + Exonic
1091661825 12:2389916-2389938 CATTTGTCAGAGTGCACAGGAGG + Intronic
1094704004 12:32896993-32897015 CAGGTGTCCGCGCGCTCAGCGGG - Intergenic
1099505470 12:83470901-83470923 CAGATGTCTGAGTGGGCAGGAGG - Intergenic
1117374467 14:55108109-55108131 CAGTGGTCAGCGTGGGCGGGTGG + Intergenic
1120854236 14:89199168-89199190 AAGTTGCCCGAGTGAGCAGGAGG + Intronic
1122094742 14:99362731-99362753 CAGCTGGCAGGGTGCGCAGGGGG + Intergenic
1142656878 17:1400230-1400252 CAGTTGTCCGCGTGCGCAGGCGG - Exonic
1142704229 17:1684407-1684429 CGGGTGTGCGCGCGCGCAGGCGG - Intronic
937657841 2:124397346-124397368 CACTTTTCCTGGTGCGCAGGTGG + Intronic
1171444534 20:25194672-25194694 CAGATGCCCCAGTGCGCAGGTGG + Intergenic
1181332265 22:22102380-22102402 CACTTGTCAGCATGCACAGGTGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182585732 22:31343466-31343488 CAGATGCCCGCCTGAGCAGGTGG + Intronic
950097762 3:10339773-10339795 CAGTGGTCTGCGGGCGCTGGTGG - Intronic
976316385 4:83663631-83663653 CTGTTCTCCCAGTGCGCAGGCGG + Intergenic
979278187 4:118836179-118836201 TGGCTGTGCGCGTGCGCAGGCGG - Intronic
996434952 5:123423563-123423585 CAGTAGTGCGCTTGCGCAGCTGG - Intronic
996543101 5:124649895-124649917 CATTCGTGCGCGTGCGCATGTGG + Intronic
1018247072 6:161833615-161833637 CGGATGTCCGGGTGGGCAGGTGG + Intronic
1018933810 6:168260447-168260469 CAGCTGACCGCGTGTGCAGCAGG + Intergenic
1019423644 7:963157-963179 CAGGTGTCAGCGGGGGCAGGTGG + Intronic
1025152469 7:56569383-56569405 CAGTTGTCCGCGTGCGCAGGTGG - Intergenic
1035270948 7:157719512-157719534 AAGTTCTCCGCGTTCCCAGGAGG - Intronic
1035278145 7:157760190-157760212 CAGTTTCCCACGTGCTCAGGGGG + Intronic
1035616846 8:1008669-1008691 CAGCTGTCCGCCTCTGCAGGAGG + Intergenic
1050941911 9:11471387-11471409 CAGGTGTGCGCATGCTCAGGGGG + Intergenic