ID: 1142664733

View in Genome Browser
Species Human (GRCh38)
Location 17:1456155-1456177
Sequence GCGCGCGCCCCTCCGGCCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 6, 3: 46, 4: 354}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142664726_1142664733 9 Left 1142664726 17:1456123-1456145 CCTCCGCGCCTAAACGCTGGGGT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG 0: 1
1: 0
2: 6
3: 46
4: 354
1142664722_1142664733 18 Left 1142664722 17:1456114-1456136 CCATGGCTGCCTCCGCGCCTAAA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG 0: 1
1: 0
2: 6
3: 46
4: 354
1142664727_1142664733 6 Left 1142664727 17:1456126-1456148 CCGCGCCTAAACGCTGGGGTGCC 0: 1
1: 0
2: 0
3: 1
4: 34
Right 1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG 0: 1
1: 0
2: 6
3: 46
4: 354
1142664720_1142664733 22 Left 1142664720 17:1456110-1456132 CCCGCCATGGCTGCCTCCGCGCC 0: 1
1: 0
2: 0
3: 21
4: 266
Right 1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG 0: 1
1: 0
2: 6
3: 46
4: 354
1142664728_1142664733 1 Left 1142664728 17:1456131-1456153 CCTAAACGCTGGGGTGCCGCCGC 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG 0: 1
1: 0
2: 6
3: 46
4: 354
1142664721_1142664733 21 Left 1142664721 17:1456111-1456133 CCGCCATGGCTGCCTCCGCGCCT 0: 1
1: 0
2: 3
3: 29
4: 259
Right 1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG 0: 1
1: 0
2: 6
3: 46
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142664733 Original CRISPR GCGCGCGCCCCTCCGGCCCC CGG Exonic
900126683 1:1071864-1071886 GCCCCTGCCCCCCCGGCCCCCGG - Exonic
900180160 1:1307738-1307760 GCGCCCACCCCGGCGGCCCCGGG + Intronic
900244269 1:1630306-1630328 GCGAGCGCCGCCCCCGCCCCCGG + Exonic
900251508 1:1672712-1672734 GCTTGTGCCCCTCCAGCCCCAGG + Intronic
900349558 1:2228181-2228203 TCGCGCCCGCCGCCGGCCCCCGG - Intergenic
900349623 1:2228386-2228408 GCGCGCCCCCCGCGAGCCCCGGG + Intergenic
900368168 1:2319943-2319965 CCGCCCGCCCCTCTGCCCCCGGG + Intergenic
900391072 1:2434199-2434221 GCGCGGCCCCCGCCGGCCCCTGG - Intronic
900718735 1:4161471-4161493 GGGGGCGCCCCGCCTGCCCCTGG + Intergenic
901007723 1:6179902-6179924 GCCCCCGCCGCTCTGGCCCCAGG + Intronic
901088333 1:6625421-6625443 GCGCCAGCCCCTCTGGGCCCAGG - Intronic
901242975 1:7705352-7705374 ACGCGCGCCCCTCACGCCCTCGG - Intronic
901667739 1:10836015-10836037 GCCCGCGGTCCTCCCGCCCCTGG - Intergenic
901934700 1:12619233-12619255 GCTCTCGCTCCTCCGGCCCCGGG - Intergenic
902286123 1:15409814-15409836 GCGCGCCCCGCCCCCGCCCCCGG - Intergenic
903750581 1:25618050-25618072 GCCCCCGCCGCGCCGGCCCCGGG + Exonic
904529941 1:31161739-31161761 CTGCGCACCCCTCCGGCCCCAGG - Intergenic
904585262 1:31576542-31576564 GCCCGCGCGCCTCCGCCTCCTGG - Exonic
905548531 1:38818271-38818293 GCGCTGGCCCCTCCGGACCCTGG + Intergenic
905617061 1:39408760-39408782 GGGCGTTCCCCTCTGGCCCCGGG + Intronic
907296587 1:53459777-53459799 CCGCGCGGCCCTCGGGTCCCGGG - Exonic
910337894 1:86155218-86155240 GCGCGCTCTCTTCCGACCCCTGG - Intronic
912764385 1:112395954-112395976 GCTCGCGCCCCTCCCGGCTCGGG - Intergenic
913191747 1:116418759-116418781 GCGCGCCCGGCTGCGGCCCCAGG + Intergenic
916792603 1:168136973-168136995 GGCCGGGCCCCTCCGGCCCCCGG + Intronic
921138817 1:212285972-212285994 CCCCACGGCCCTCCGGCCCCGGG - Exonic
922306977 1:224352737-224352759 CCGCGGGCCCCGCCGGCCCTGGG - Intergenic
922460251 1:225810177-225810199 GTGCGGGCCCGGCCGGCCCCGGG - Intronic
923782990 1:237042402-237042424 GCGCGGCCCCCTCCAGCCCCCGG + Exonic
1062774508 10:134902-134924 GCGTGCACGGCTCCGGCCCCGGG + Intronic
1063201120 10:3785767-3785789 GCGGGCGGCCGTCCGGTCCCGGG + Intergenic
1063458993 10:6203577-6203599 GCGCGCGTCCCTCCGTCTCGGGG - Intronic
1063930015 10:11018606-11018628 CCGCCCGCCCCACCGGACCCCGG - Intronic
1065188811 10:23192768-23192790 GCGCTCGCCCCGCCGTCCTCGGG + Exonic
1066126479 10:32347264-32347286 GCGCGCGTCCCGCCAACCCCCGG + Intronic
1066296094 10:34055653-34055675 GAGCAGGCCCCACCGGCCCCAGG + Intergenic
1067669455 10:48306426-48306448 GGGCCCGCCCCTCCCGCTCCAGG + Intergenic
1069186533 10:65429670-65429692 CCGCCAGCCCCGCCGGCCCCGGG - Intergenic
1069818360 10:71212739-71212761 CGGCGCGCCCCTCTGGCTCCGGG - Exonic
1070147523 10:73785779-73785801 CGGCTCGCCCCTCAGGCCCCGGG + Exonic
1070333010 10:75431427-75431449 GCCCGCGCCCCTCCCTCCCCCGG - Intergenic
1070570702 10:77637905-77637927 GCCCGCGCCCCGCTCGCCCCGGG + Intronic
1070579895 10:77711327-77711349 GAGCGCGCCCCTCAGAGCCCAGG - Intergenic
1070778417 10:79123707-79123729 TCGCCAGCCCCTCCAGCCCCTGG + Intronic
1070915044 10:80148194-80148216 GTGGGCGCCCCTCTGGCCCAGGG - Intergenic
1073520282 10:104122007-104122029 GCGCGCGCGCCTCCGCCAGCGGG - Intergenic
1074996356 10:118760409-118760431 CAGCGGGCCCCGCCGGCCCCGGG - Intergenic
1075522554 10:123151637-123151659 GGGCGAGCTCCTCCGGCCTCTGG + Intergenic
1076636673 10:131885572-131885594 GAGCGCAACCCTCCGGCCCTGGG - Intergenic
1076657813 10:132036451-132036473 ACGCGCGCCCCGCGGCCCCCGGG + Intergenic
1076727902 10:132421865-132421887 GGGCAAGCCCCTCCGGCTCCAGG - Intergenic
1076849946 10:133087874-133087896 ACGCGCCTGCCTCCGGCCCCGGG + Intronic
1078066321 11:8081450-8081472 GCGCCGGCCCCTCCGGGCCCCGG + Intronic
1078210319 11:9265129-9265151 GCGCCCGCCCGTCCGCCCTCAGG + Exonic
1080458877 11:32436808-32436830 ACACGCTCCGCTCCGGCCCCCGG - Intergenic
1080779709 11:35419188-35419210 CCGCGCTCCCCTCCGCCCGCGGG + Exonic
1081872992 11:46391677-46391699 CCGCCCGCCCCGCCGGCCCGCGG - Intergenic
1082001474 11:47395568-47395590 GCCCGTGCTCCTCCAGCCCCAGG + Intergenic
1082003600 11:47408212-47408234 GCGCGCCCCCGTGCGGCCACGGG + Intronic
1082658051 11:55874586-55874608 CCGCCCACCCCTCCGGCCGCCGG - Intergenic
1082816827 11:57514822-57514844 GCTTGCCCCCCTCCAGCCCCGGG + Intronic
1083656968 11:64234504-64234526 ACGCGCTCCCCACCGGCCCGTGG - Intergenic
1083753651 11:64777920-64777942 CCGCGCGCCCCTCAGGCGGCCGG + Intronic
1083883083 11:65557974-65557996 GGGCGCGCCCCCCCTCCCCCGGG - Exonic
1083901379 11:65645137-65645159 GCTCCCACCCCTCCTGCCCCTGG - Intronic
1083920994 11:65781300-65781322 GCGCGCCCCCCGCCGGCGCCCGG + Intergenic
1084310276 11:68312687-68312709 GCGCGGGCCCGTCCGGCCGCCGG + Exonic
1084515595 11:69636739-69636761 GAGCGCGCGCCGCCGGACCCTGG - Intergenic
1084946688 11:72642482-72642504 GCCCGCCCCCCGCCCGCCCCCGG + Intronic
1084972962 11:72781504-72781526 GCGGGCGCCCGTCGGGACCCAGG + Intronic
1084979608 11:72822161-72822183 GCGCGCGCACGTCGGGCTCCGGG + Exonic
1085666210 11:78417603-78417625 GAGCGCCCCCCGCCCGCCCCTGG + Intronic
1088223180 11:107591052-107591074 GCGCCCGCGCCCCCGGCTCCCGG + Intergenic
1088495801 11:110430240-110430262 CCGCGCTCCCGCCCGGCCCCCGG - Exonic
1088606776 11:111540668-111540690 TCGGTCGCCCCTCCGCCCCCTGG - Exonic
1088878968 11:113958816-113958838 GCCCACGCCCCTCCCACCCCAGG + Intergenic
1089527584 11:119107432-119107454 GCGCGGGCCCCGCCGGACCCTGG - Exonic
1089543626 11:119206179-119206201 GGACGCGCCCCGCCCGCCCCGGG + Exonic
1090250904 11:125251039-125251061 GCGGGCGCCCCTCCACCCCCTGG + Intronic
1090375198 11:126283255-126283277 GCGCGCACCCCTGCGGCTCTCGG - Intronic
1090788595 11:130070402-130070424 GCGCCCGCCCCGCCCTCCCCCGG + Intronic
1091225912 11:133956480-133956502 CCGCCCGCCCCTCCAGCCCACGG + Intronic
1091367965 11:135037859-135037881 GCCCCCGCCCCTCCCACCCCCGG + Intergenic
1091393252 12:138707-138729 GCGCCCGCCCCTCGGCCTCCAGG - Exonic
1093931829 12:24961568-24961590 GCGGGCTCCCCTCTGGCCCAGGG - Intergenic
1096106246 12:48998353-48998375 GCGCTCGCCCCACAGGCGCCAGG + Exonic
1096127447 12:49130375-49130397 GCGCGCGCTCTTGCGCCCCCCGG + Intronic
1096770955 12:53935820-53935842 GGGCGCGCCCCGCCGGCCTTCGG - Intergenic
1098498774 12:71166470-71166492 GGGCCGGCCCCGCCGGCCCCTGG - Intronic
1101679970 12:106955636-106955658 GCTCCCGCCCCTTCGCCCCCTGG - Intergenic
1102197141 12:111033934-111033956 CCGTGCGCCCCCCCGACCCCCGG - Intergenic
1105876697 13:24560967-24560989 GGGCGGGCCCTACCGGCCCCAGG - Intergenic
1111123028 13:83879331-83879353 GTACACGCCCCTCCAGCCCCCGG + Exonic
1111672589 13:91348441-91348463 GCGCGCCCCCTCCCGGCCCGCGG - Intergenic
1112752605 13:102597354-102597376 GCGCCCGTCCCTCCCGCGCCTGG - Intronic
1113840314 13:113355518-113355540 GCGTGGGCCCCGCAGGCCCCTGG - Intronic
1113926190 13:113943007-113943029 GCGCTGGCCCCTCGGGTCCCTGG + Intergenic
1113954116 13:114087686-114087708 GCGGGCGCCCTGCTGGCCCCGGG - Intronic
1115203213 14:30874977-30874999 GTGCGCGCCCCTCACGACCCCGG + Intronic
1115850047 14:37583955-37583977 GCCCGCGCCCCCCCGAGCCCAGG + Intergenic
1118366607 14:65102131-65102153 GTTCGCTCCCCTCCGGCTCCTGG - Intronic
1121304744 14:92899016-92899038 CCGTGCGCCCCTCCGCCTCCCGG - Intergenic
1122077544 14:99245895-99245917 GCGAGCACGCCTCTGGCCCCGGG - Intronic
1122145124 14:99684311-99684333 CCGCGCGCCGCCTCGGCCCCAGG - Exonic
1122688986 14:103522733-103522755 GCGCGGACGCCCCCGGCCCCCGG + Intronic
1122847830 14:104510414-104510436 GCCCCCTCCCCTCCTGCCCCAGG + Intronic
1123004458 14:105314694-105314716 GCCCGCGCCCCGCGCGCCCCCGG - Exonic
1123739937 15:23226431-23226453 GCGCGCACCCCTCCCGCCAGCGG + Intergenic
1124291161 15:28455399-28455421 GCGCGCACCCCTCCCGCCAGCGG + Intergenic
1124696909 15:31870859-31870881 GCCCCCGCCCCTCCGGGGCCGGG + Intergenic
1127142733 15:55993760-55993782 GCGCGCCCCCGCCCAGCCCCAGG - Intergenic
1127415131 15:58749912-58749934 GCGCGCGCCCCTGAAGCGCCTGG - Exonic
1128109533 15:65067888-65067910 GCGCCCGCCCGTCGGGGCCCAGG + Exonic
1128528912 15:68431209-68431231 CCGCGCGCCCCTCGGGCCGGAGG + Intronic
1129150434 15:73684658-73684680 GCGGGCGCCCCTCCTGCCCTGGG + Intronic
1129162240 15:73753219-73753241 GCCCGCGCCCCGGCCGCCCCCGG + Intergenic
1129260794 15:74366049-74366071 GCCCGAGCCCATCCGCCCCCCGG - Intronic
1129675956 15:77632554-77632576 GCGCCCGCCCATCCGCCCGCCGG - Intronic
1129676143 15:77633170-77633192 GGCCGCGCCCCTCCGGGTCCGGG + Intronic
1129933692 15:79432180-79432202 GCCCGCGCTCCAGCGGCCCCGGG - Intergenic
1131260256 15:90884245-90884267 GCCCGCGCCCCGCAGGCCCCAGG - Intronic
1131431943 15:92394625-92394647 CCGCCCTCCGCTCCGGCCCCAGG - Intronic
1131826010 15:96322921-96322943 GCTCGCGCCCCCTCGGCCCGGGG + Intergenic
1131870969 15:96764592-96764614 CCCCGCCCCCCTCCGGCCTCAGG + Intergenic
1132079470 15:98852298-98852320 GCGCGCGCCCCACCCCGCCCCGG + Intronic
1132186711 15:99807019-99807041 GGGCGCGTCTCTCCGGCTCCTGG + Intergenic
1132320027 15:100919130-100919152 CCGCGGGCCCTTCCGGCACCGGG - Intergenic
1132365086 15:101251457-101251479 GCCCGCGCCGCTCCGCCCGCCGG + Exonic
1132428976 15:101745692-101745714 GGGCGCGTCTCTCCGGCTCCTGG - Intronic
1132527837 16:426231-426253 GCGGGCCTCCCTCCAGCCCCGGG - Exonic
1132552775 16:560247-560269 GCGCGCCCCCCGCCGCCCCCTGG - Intergenic
1132719686 16:1309616-1309638 CCGCGCGCCCCGCCCGCGCCAGG + Intronic
1132849852 16:2020099-2020121 GCGCGCGGCCGCCGGGCCCCTGG + Exonic
1132888021 16:2190979-2191001 GCGTGGGCCCCTCTGGCCTCAGG - Intronic
1133020194 16:2963737-2963759 CCGCACGCCCCTCCCGCCCCTGG - Intergenic
1134134163 16:11668614-11668636 GCGCGCGCCCCTCCTCGTCCTGG - Intronic
1135517702 16:23149297-23149319 GCGCCCGCCCGCCCGGCCCGCGG + Intergenic
1135976124 16:27109878-27109900 GCGGCCGCCCCTCCTTCCCCGGG + Intergenic
1136110797 16:28062898-28062920 GCGCGCGCCGTTCCGGGGCCGGG - Intronic
1136419603 16:30123369-30123391 GCGCCCGCCCTTCTTGCCCCAGG + Intronic
1136505321 16:30699059-30699081 GCGCGGGCCCCTCCCCCGCCCGG + Intronic
1136707608 16:32202266-32202288 GCGCGCACCCCTCCTGCCAGCGG - Intergenic
1136760302 16:32727144-32727166 GCGCGCACCCCTCCTGCCAGCGG + Intergenic
1136807802 16:33143242-33143264 GCGCGCACCCCTCCTGCCAGCGG - Intergenic
1137655166 16:50153231-50153253 GTCCTCGCTCCTCCGGCCCCGGG - Intronic
1137748506 16:50841247-50841269 CTGCGCGCCCCGCCGGCCCGCGG - Intergenic
1138229150 16:55324879-55324901 GAAGGCGCCCCTCCGGCCCGTGG - Exonic
1138450908 16:57092985-57093007 GGGGGCGCCCCGCCGGCTCCCGG + Intronic
1139496930 16:67326761-67326783 GCGCGCGCCGCCGCGACCCCGGG - Exonic
1139754581 16:69132367-69132389 CCGCGCGCCCCGCCCGGCCCCGG + Intronic
1141493408 16:84390217-84390239 GCGCCCTCCCGTCCAGCCCCGGG - Intronic
1141694020 16:85611632-85611654 GCGCCCCCACCTCCGGGCCCCGG + Intronic
1142429754 16:90019584-90019606 GCGCGCCCCCTGCTGGCCCCTGG + Intronic
1203062456 16_KI270728v1_random:987466-987488 GCGCGCACCCCTCCTGCCAGCGG + Intergenic
1142664733 17:1456155-1456177 GCGCGCGCCCCTCCGGCCCCCGG + Exonic
1143483481 17:7239719-7239741 CCGCTCTCCCCTCCGGCTCCTGG - Intronic
1144675577 17:17159315-17159337 GCTCGCGCCCCTCCTGCCATCGG - Intronic
1145863291 17:28225377-28225399 GAGCCAGCCCCTCCAGCCCCAGG - Intergenic
1146183317 17:30710247-30710269 GCGCGCCGCGCGCCGGCCCCGGG + Intergenic
1147684052 17:42276405-42276427 GCGCGCGCCCCCGCGGGCCCCGG - Exonic
1147927659 17:43955341-43955363 GAGCCAGCCCCTCCAGCCCCAGG + Intronic
1147992870 17:44345660-44345682 TCGCGCGCCCCTCCGGCTCCAGG - Intronic
1148206841 17:45784604-45784626 GCGCTGGCGCCCCCGGCCCCTGG + Intronic
1149997300 17:61411882-61411904 GAGCGCGCCCCTCCCGCCCCAGG - Exonic
1151801732 17:76383289-76383311 GCGCGCGGAGCTGCGGCCCCAGG + Intronic
1151890272 17:76947402-76947424 TCGCGGGGCCCTCCGGCCCCTGG + Intronic
1152087989 17:78231959-78231981 GCGCGCCCCCCGCCGCCCCCGGG + Exonic
1152183487 17:78840207-78840229 GCGGCCGCCACTCCAGCCCCAGG + Intronic
1152357349 17:79813545-79813567 GCCCGCCCCCCTCCGGCCGCCGG - Intergenic
1152628695 17:81399972-81399994 GCGCCCACCCCTCCGCTCCCGGG + Intronic
1152683870 17:81684177-81684199 GTCCGCGCCCCTCGGGCCCTCGG - Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1152824961 17:82458838-82458860 GCGCGCGCCTCCCCGGCCCGCGG - Intronic
1153051921 18:908167-908189 GCGCGCGCCCCCTCGGCGGCCGG - Intronic
1153201919 18:2655795-2655817 GCGCGCTCCTCACCGGGCCCGGG - Exonic
1153285015 18:3449375-3449397 GCGCGCGCCCGGCCGTCCCCGGG + Intronic
1153457234 18:5295285-5295307 CCGCGCGCCGCCCCCGCCCCCGG - Intronic
1154501422 18:14999651-14999673 GAGCGCGCCCCGCGCGCCCCCGG - Intergenic
1155877198 18:31101942-31101964 CAGCCCGCCCCTCCGGCTCCTGG - Exonic
1157338188 18:46756570-46756592 CCGCGCGCCCCCCGGGGCCCCGG - Exonic
1157752933 18:50194719-50194741 GAGCGCGCCACCCCGGCCCCGGG + Intronic
1160136286 18:76274348-76274370 GCGGGCTCCCCTCAGCCCCCTGG - Intergenic
1160163400 18:76491733-76491755 GCGCTCTCGCCCCCGGCCCCTGG + Intronic
1160204752 18:76823028-76823050 CCCCGCGGCCCTCCGGCCCCGGG - Intronic
1160500681 18:79400057-79400079 GCGCAGGCTCCTCCGGACCCGGG - Intronic
1160592140 18:79951001-79951023 CCGCGCGCTCCTGCGGCCTCGGG + Exonic
1160719191 19:590067-590089 CCGCGCCCCCCCCGGGCCCCGGG + Exonic
1160732098 19:645954-645976 GCCCGCACCCCTGCGTCCCCGGG - Intergenic
1160766817 19:812537-812559 GCCCGCCCCCCGCCCGCCCCCGG + Exonic
1160807946 19:1000842-1000864 GCGCGCGCCCCTCGGAGCCCCGG + Exonic
1160858794 19:1229027-1229049 GCGAGCGCGCCTCCGTCGCCCGG + Exonic
1161022126 19:2015507-2015529 CCGCCCGCCCCGCCGGGCCCCGG - Exonic
1161072815 19:2270913-2270935 ACGCGCCCCGCTCCGGCTCCCGG - Intronic
1161080558 19:2308040-2308062 GCGCGCCCCACGCCGGGCCCCGG + Intronic
1161388098 19:4007637-4007659 GCGCGCGCTCCTCCCGCCGCCGG - Exonic
1161447530 19:4326941-4326963 GCGCCCTCCGCTCCGGGCCCAGG - Exonic
1161494961 19:4581600-4581622 GCGCGCGCTCTCCCCGCCCCCGG + Intergenic
1161550616 19:4910203-4910225 GCTCGCGCCCCTCCAAACCCTGG - Intronic
1161686829 19:5707050-5707072 GCGGGCTCACCTCCCGCCCCAGG + Exonic
1161802589 19:6424421-6424443 GAGCGCGCCCCTCAGGCCCTCGG + Intronic
1161810298 19:6467614-6467636 GCGCGCTCACCTCCAGCCACGGG - Exonic
1162396340 19:10420017-10420039 GTGCGCGCACATCCCGCCCCGGG + Intronic
1162727055 19:12696126-12696148 GGGCGGGCGCCCCCGGCCCCCGG + Intronic
1162814743 19:13186966-13186988 TGGCCCGCCCCACCGGCCCCGGG - Intergenic
1162929907 19:13952651-13952673 GCGCTCCCCACTCCGGCTCCAGG - Intronic
1163453041 19:17390517-17390539 GTGCGCGCCGCGCCGGCCGCCGG + Intergenic
1163490812 19:17616339-17616361 GCCTGCGCCCCTCCTGGCCCCGG - Intronic
1163587881 19:18173718-18173740 GCCCACGCCCCTCGGGTCCCGGG - Exonic
1163762654 19:19145921-19145943 GAGCGCCTCTCTCCGGCCCCCGG - Exonic
1164834757 19:31349901-31349923 GCGCCCCCGCCCCCGGCCCCAGG + Intergenic
1165749823 19:38253043-38253065 GCAGGAGCCCCACCGGCCCCAGG + Intronic
1165843995 19:38806460-38806482 AGGCCAGCCCCTCCGGCCCCAGG - Exonic
1166039096 19:40191550-40191572 GGGCGCGCCACCCCGGCCCGGGG + Intergenic
1166306857 19:41940249-41940271 ACCCCCGCCCCTCCGCCCCCGGG - Intergenic
1167097309 19:47381248-47381270 GCATGCGCCCCTCACGCCCCTGG + Exonic
1167104486 19:47422061-47422083 GCGCCCGCCCCTCCGCCCGCTGG + Intergenic
1167466271 19:49652379-49652401 GCGCCCGCCCCGCCGCCCTCTGG + Exonic
1168307219 19:55442324-55442346 GCCCTCGCCCCCGCGGCCCCCGG + Exonic
1168455900 19:56508048-56508070 ACGCGCGCCCCGCTGGCCTCTGG - Intronic
926077084 2:9950883-9950905 GCGCGCCCCGGGCCGGCCCCGGG - Intergenic
926190081 2:10721710-10721732 GCCCGCGCCCCGCCGGCTCCCGG + Exonic
926672857 2:15591843-15591865 CGGCGCGCGCTTCCGGCCCCTGG - Exonic
927357071 2:22186441-22186463 CCGCGGGCCCCGCCGGCCCCGGG + Intergenic
927809371 2:26173116-26173138 GCGAGCGCCGCGGCGGCCCCGGG + Exonic
927830562 2:26346335-26346357 GCGCGGGCCCCTCAGCCGCCTGG - Intronic
928518268 2:32063919-32063941 GCCCCCGCCCCTCCCGCCGCCGG + Exonic
928998729 2:37324818-37324840 GCCCCCCGCCCTCCGGCCCCAGG - Intergenic
929313570 2:40452149-40452171 GCGCGCGCGCGCCCGGGCCCCGG - Intronic
929789793 2:45014067-45014089 GCCCGCGCCCCTCCGCACCCAGG - Intergenic
930096462 2:47570347-47570369 CCGAGCGCCGCCCCGGCCCCGGG - Exonic
931711000 2:64989165-64989187 GCCCGCGCCCCCGCGGCCTCGGG + Intronic
932562807 2:72887681-72887703 GCGCGAGCTCCCCCGGCCCAAGG + Exonic
932880108 2:75493310-75493332 GCTCGCGCTCCTCCAGCCGCTGG + Exonic
933847453 2:86337395-86337417 GCGCGCGCCCCTACAGCGCCCGG - Intronic
934763811 2:96869630-96869652 TGGCGCGCCCCTCCGGCCCCGGG + Intronic
935265111 2:101387193-101387215 GGACGCGCACCTGCGGCCCCGGG - Exonic
936038282 2:109129478-109129500 GCGGGCTCCACGCCGGCCCCGGG + Intronic
936561206 2:113541497-113541519 GCGGGCTCCTCTCCGGCGCCAGG - Intergenic
937104200 2:119294858-119294880 GCCCGGACCCCTCTGGCCCCAGG - Intergenic
937221678 2:120345935-120345957 CGGCGCGCCCCTCGGGCCCCCGG + Intergenic
937950910 2:127387575-127387597 TCGCGCGCCCCTCCGGTCCCCGG - Intronic
937951018 2:127388018-127388040 GCGCGCACCCCTCCGCCCGGCGG + Intronic
938410155 2:131056904-131056926 TCGCATGCCCCTCTGGCCCCTGG - Intronic
939580053 2:143937102-143937124 GCGCGGGCCCCGCCAGCCCCTGG - Intergenic
939800448 2:146700677-146700699 GCGGGCTCCCCTCTGGCCCAGGG - Intergenic
940887500 2:159002173-159002195 CCGCCAGCCCCTCCGGCCGCAGG - Intronic
943309736 2:186310854-186310876 GTGGGCTCCCCTCTGGCCCCGGG - Intergenic
943767474 2:191678215-191678237 GCGCGCGCCCAGCCTGTCCCGGG - Intronic
946227027 2:218269658-218269680 CCGCGCGCCCCCGCGGACCCCGG - Intronic
946397038 2:219448418-219448440 GCCGGCGCCCCTGCGGCCCTGGG + Exonic
947593071 2:231395951-231395973 CCGCCCGCCCATCCGCCCCCGGG - Intronic
948207155 2:236168321-236168343 GCGCGCTCCCCAGCGGCCCGCGG - Exonic
948438083 2:237967259-237967281 GCCCGCGCCCGCCAGGCCCCCGG - Intronic
948465874 2:238151390-238151412 GCGAGCCCCACTCCTGCCCCTGG + Exonic
948487261 2:238288811-238288833 GCGCGCGCCGCGCCCGCCCCCGG + Intronic
948851689 2:240711430-240711452 GCCTGCGCCCCTCTGGCCCTGGG + Intergenic
948884018 2:240874123-240874145 GCTCCCGCCCCTCCCGCCTCGGG - Intronic
948953852 2:241272499-241272521 GTGCGCGCCCCTCCGCGCCACGG + Intronic
948958559 2:241314986-241315008 GCGCGGGCGGCTCCGGCCCGCGG - Intronic
949017375 2:241720946-241720968 GGGCGGTCCCCTCAGGCCCCCGG + Intronic
1168854954 20:1002014-1002036 GCCCCCGGTCCTCCGGCCCCCGG + Intronic
1169327441 20:4686934-4686956 GCGCGAGCCCCGCGGCCCCCAGG - Intronic
1170999273 20:21396833-21396855 CCGCGCGCCCGCTCGGCCCCAGG + Intronic
1171417440 20:24992640-24992662 GCGCCGGCCCCTGCGGCCGCAGG - Exonic
1171449364 20:25225140-25225162 GCACTTGCCCCTCCGCCCCCAGG + Intronic
1171908888 20:30922431-30922453 GCGCGCCCGCCTCCGGCTCTCGG + Intergenic
1174204477 20:48828486-48828508 ACGCGCGCCTCCGCGGCCCCGGG + Intergenic
1174611427 20:51801458-51801480 GCGCCCGCCACCCCGGCCACTGG + Intronic
1175545242 20:59773704-59773726 GCGTGAGCCCCTCAGGACCCAGG + Intronic
1175715478 20:61252337-61252359 GCGCTCGCCGCCCCGGCTCCGGG - Intergenic
1175856042 20:62121837-62121859 GCCCGCCCCCCGCCGGCACCTGG + Intergenic
1175866351 20:62179252-62179274 CCGCCAGCCCATCCGGCCCCTGG - Exonic
1176547887 21:8209265-8209287 GCGCGCGCCCCGGCGCCCGCGGG - Intergenic
1176556898 21:8257762-8257784 GCGCGCCCGCCTCCGGCTCGCGG + Intergenic
1176567936 21:8396580-8396602 GCGCGCCCGCCTCCGGCTCGCGG + Intergenic
1176575840 21:8440799-8440821 GCGCGCCCGCCTCCGGCTCGCGG + Intergenic
1178708196 21:34890784-34890806 GCGCGCGCCCGCCCGCCCGCAGG + Intronic
1179511960 21:41879211-41879233 GCGTGCGCCCCGCCGGCCCCGGG - Intronic
1179558313 21:42194714-42194736 GCACGTGCCTCTCCAGCCCCAGG - Intergenic
1179603524 21:42496751-42496773 GCCCGCTCCCTTCCGCCCCCAGG + Intronic
1179605550 21:42513566-42513588 GCGCGCTCCCCACCGGCCTCCGG - Intronic
1181811318 22:25405280-25405302 GCGCCAGCCCGTCCGGCCGCTGG - Intronic
1183068621 22:35380968-35380990 GCCCGCGCCCAGCCCGCCCCGGG - Exonic
1183220204 22:36507170-36507192 GCGCGCGCCTCTCCCGCGCTGGG - Intergenic
1183537736 22:38412991-38413013 CCGCGGGCCCCTGCGGGCCCCGG - Intergenic
1183939624 22:41286020-41286042 GAGCGCGCGCCTCCGCCCTCTGG + Intronic
1184236709 22:43186994-43187016 GCGCGCCCTCCTCCGGCGTCTGG + Exonic
1184337523 22:43862470-43862492 GCTCGCGCCCCACCGGCGCGCGG + Exonic
1184697955 22:46150369-46150391 CCGCGCGCCCTCCGGGCCCCGGG - Intergenic
1185315487 22:50177210-50177232 GCGCGCGGCCCTCGGCCGCCCGG - Exonic
1185324030 22:50216899-50216921 GCACGCGACCCGCCGTCCCCCGG - Intronic
1185366348 22:50438702-50438724 GCAGGTGCCCCACCGGCCCCCGG + Exonic
1185387782 22:50544242-50544264 GCGCCAGCCCCGCCGGCCCCAGG - Intergenic
1203253891 22_KI270733v1_random:129857-129879 GCGCGCCCGCCTCCGGCTCGCGG + Intergenic
1203261947 22_KI270733v1_random:174936-174958 GCGCGCCCGCCTCCGGCTCGCGG + Intergenic
950115816 3:10449759-10449781 CCCTGAGCCCCTCCGGCCCCTGG - Exonic
963168035 3:142225157-142225179 GGGCGCGCCGTTCTGGCCCCAGG + Intronic
964014364 3:151928254-151928276 GGGCGGGCCCCGCCGACCCCGGG + Intergenic
965256774 3:166424075-166424097 GGGCGGGCCCCACCGGCCCCAGG + Intergenic
967272658 3:187743924-187743946 GCGCCCGCTCCTCCCGCGCCGGG + Intronic
968114966 3:196082207-196082229 GCGCGCGCATCCCCGCCCCCCGG - Intergenic
968556570 4:1248881-1248903 GCGCGCGCGTTTCCGGCCGCGGG - Intronic
968698067 4:2042281-2042303 GCGCCCGCCCCGCCCGCCCCGGG - Intronic
971195752 4:24471009-24471031 GCGCGCTCCCTCCCGGGCCCGGG - Intergenic
972686779 4:41360343-41360365 GCGCCCGCTCCCCCGGGCCCGGG + Intronic
974875702 4:67700904-67700926 GCGCGCGCCCCTCGCCTCCCAGG + Intronic
976451842 4:85199527-85199549 GTGGGCTCCCCTCTGGCCCCGGG + Intergenic
978619022 4:110621466-110621488 GCGCACCCTCCTCCGGCGCCAGG - Intronic
979565044 4:122145569-122145591 GCAGGCTCCCCTCCGGCCCAGGG + Intergenic
981128404 4:141132624-141132646 CCGCCCGCCGCCCCGGCCCCGGG + Exonic
981504160 4:145481954-145481976 GCGCCCGGCCGTCCGGACCCGGG + Intronic
985068446 4:186144978-186145000 TCACGCGCCCCCGCGGCCCCGGG - Exonic
985549162 5:524480-524502 CCGCGGCCCCCTCCCGCCCCGGG + Intergenic
985778716 5:1858561-1858583 CCCCGCGCCCCTCCTGGCCCAGG - Intergenic
989812589 5:45695945-45695967 GCGCCGGCCCCGCCGCCCCCCGG + Exonic
990376537 5:55176443-55176465 TTGCGCGCCCCTCCGGCCCGCGG + Intergenic
992530105 5:77645240-77645262 GCCCGCGCCCCTCCCCGCCCGGG + Intergenic
997583941 5:135033907-135033929 GCGCGCCCAGCCCCGGCCCCTGG - Exonic
1001902704 5:175444686-175444708 GCGCGCGCCGCTGCGCCCCGAGG + Intergenic
1002476558 5:179469524-179469546 GCACGCGCCCCACCCACCCCAGG - Intergenic
1002692433 5:181059580-181059602 GCGCGTGCCCCCGCGGCGCCTGG + Exonic
1002928642 6:1619286-1619308 GGGCGCGCCCCCCTCGCCCCTGG - Intergenic
1003290532 6:4775831-4775853 GCGCCCGCCCGTCCGGGGCCGGG - Intronic
1004044560 6:12012064-12012086 GCGCCCGTCCTTCCCGCCCCGGG + Intronic
1004044627 6:12012247-12012269 GCGCTCCCCCCCCCGCCCCCCGG + Intronic
1005512285 6:26521773-26521795 GCTCCAGGCCCTCCGGCCCCGGG + Intergenic
1006027836 6:31158576-31158598 GGCCGCGCCCCTCCTGGCCCCGG + Exonic
1006472862 6:34237932-34237954 GCCCGCGCCTCTTCAGCCCCAGG + Intronic
1007739652 6:44002830-44002852 GCGCGCGCCCCGTCGGCGGCGGG - Exonic
1010141866 6:72622079-72622101 GCGGGCGCCCCGTCGGCCGCCGG + Exonic
1011044403 6:83065926-83065948 GCGCGCCCCGCCCCGGCCTCCGG - Intergenic
1011416282 6:87122857-87122879 GTGCGCGCCCCCCGGGCCTCGGG + Intergenic
1011640473 6:89412336-89412358 GCGCGCGCTCGCCCGGCCGCGGG + Intergenic
1013033858 6:106361216-106361238 GATCGCTCCCCTCCGGACCCGGG - Intergenic
1014437487 6:121437078-121437100 CCCCGCGCCCGTCCGGCCCACGG - Intronic
1015773755 6:136793140-136793162 GGGCGCCCCCCTCCGGGCCTTGG + Intergenic
1016863897 6:148747494-148747516 GGGGGCGCCCCTCCGGGCCTGGG + Exonic
1017873059 6:158502678-158502700 GCGGGCCCCCCTGCAGCCCCTGG + Exonic
1018727837 6:166627309-166627331 GCGCCCGCCGCTCCGCGCCCCGG + Intronic
1019016917 6:168886503-168886525 AGCCGCGCCCCTCCGTCCCCAGG + Intergenic
1019395732 7:816746-816768 CCCCGCGTCCCCCCGGCCCCCGG - Intronic
1019413315 7:916049-916071 GCGTGCCCGCCTCTGGCCCCTGG - Intronic
1019711291 7:2519424-2519446 GGGCGCGCCCCTCCCGTGCCGGG + Intronic
1019765098 7:2844177-2844199 GGCCGCGCCCCGCCGGCGCCCGG + Exonic
1020105249 7:5419740-5419762 GCGCGCGCCCCTCCCCCGCCCGG + Intronic
1021761288 7:23904971-23904993 CCGCCGGCCCCACCGGCCCCGGG - Intergenic
1022410342 7:30135023-30135045 GCGCGGGCTCCTCCGGGGCCGGG - Exonic
1024043838 7:45574491-45574513 GCGCGCCCCTCGCCGGCCCGGGG - Intronic
1024919718 7:54544762-54544784 GCGCCGGCCCCCTCGGCCCCGGG - Exonic
1029207579 7:98878677-98878699 GCGCGCGGCCCTCAGGCGCGGGG + Intronic
1029537334 7:101164165-101164187 GCGCGCGCCCCTGCCGCCCCCGG - Exonic
1029640435 7:101816469-101816491 GCGCGCACCCCGCGGGCCGCCGG - Intronic
1030597976 7:111562289-111562311 CCGCGCACCCCTCCGCCTCCCGG + Exonic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1033253071 7:139777469-139777491 TCGCGGCCCCCTCGGGCCCCGGG + Intronic
1033253313 7:139778162-139778184 GCGCGGTCCCCTCGGGCCGCCGG - Intronic
1033658399 7:143388219-143388241 GTGCGCTCCCCTGGGGCCCCAGG + Exonic
1034344720 7:150379291-150379313 GTGCCCGCCCCGCCTGCCCCGGG + Intronic
1034344817 7:150379556-150379578 CCGCGCGCCCCCCGAGCCCCGGG + Intronic
1034445978 7:151114672-151114694 GCGCACGGACCTCCGGCCTCTGG - Intronic
1034618051 7:152435993-152436015 GCGCGCGCACCTCCGCGCGCAGG + Exonic
1035167452 7:157000073-157000095 CCGCGCCCCGCTCCGCCCCCGGG - Intronic
1035187714 7:157139166-157139188 GCGCCCGCCCGCCCGGCCCGGGG - Exonic
1035388922 7:158492099-158492121 GTGAGGGCCCCTCCCGCCCCAGG + Intronic
1035560879 8:602616-602638 GCGGGTGCCCCTCCAGCCTCAGG - Intergenic
1036195160 8:6708073-6708095 CCGCGCGCACGTCCGGCCCGAGG + Intergenic
1038303951 8:26382929-26382951 GGGCGCTCCCCTGCGGGCCCCGG - Exonic
1039493655 8:37965627-37965649 GCGCGCGGGCCGCCGGCCGCAGG + Exonic
1039587602 8:38719940-38719962 TGGCGGGCCCCACCGGCCCCGGG + Intergenic
1039608473 8:38901376-38901398 GGGGTCGCCCCTCCGGCCGCCGG - Exonic
1039875181 8:41578583-41578605 GTGCGCAGCCCTCCCGCCCCGGG + Intronic
1040915718 8:52565149-52565171 GCGCGCTCCCCTGCGCCCCCGGG + Exonic
1042059090 8:64798410-64798432 GCGCGCGGCCCGCGGGGCCCAGG + Intronic
1045638638 8:104223200-104223222 GGGCGCGCGCCTCAGGTCCCGGG - Intronic
1045847813 8:106658139-106658161 GTCCCCGCCCCACCGGCCCCCGG + Intronic
1049610716 8:143553539-143553561 GGGCGAGCGCCTCCGTCCCCTGG - Exonic
1049707370 8:144049166-144049188 GCCCTCGCCCTTCCCGCCCCCGG + Intergenic
1049791133 8:144473217-144473239 GCGCGGGACCCTGCGGCGCCGGG - Exonic
1049802174 8:144522933-144522955 CCGCGTGCCCTTCCGGCTCCTGG - Exonic
1049891479 9:73819-73841 GCGGGCTCCTCTCCGGCGCCAGG + Intergenic
1053306160 9:36986147-36986169 GCCCGCGCCCCCCGGGGCCCCGG + Intronic
1057489562 9:95510851-95510873 GCGCGCGCGCGCCCGGCTCCCGG + Intronic
1057881527 9:98796301-98796323 GCCCCCGCCGCTGCGGCCCCGGG + Exonic
1058005205 9:99906765-99906787 GCGCGCGCCACACGGGCGCCAGG - Intronic
1059021196 9:110578985-110579007 GCGCCCGCCCCTCCCGACCCGGG - Intronic
1061401744 9:130372272-130372294 GCCCACGCCCCTCCCTCCCCAGG + Intronic
1061828378 9:133275402-133275424 CCGCGCGCCCCTCGTGGCCCTGG + Intergenic
1062162333 9:135087385-135087407 GCCCGCGGCCCTCCCGTCCCGGG - Intronic
1062517083 9:136942199-136942221 GCGCCCGCCCCTCCAGCACGCGG + Exonic
1062596546 9:137302337-137302359 ACGCGCGCGCCGGCGGCCCCGGG + Intergenic
1203470291 Un_GL000220v1:113001-113023 GCGCGCCCGCCTCCGGCTCGCGG + Intergenic
1203478112 Un_GL000220v1:156973-156995 GCGCGCCCGCCTCCGGCTCGCGG + Intergenic
1185467667 X:364221-364243 CCCAGCGCGCCTCCGGCCCCAGG + Intronic
1186496453 X:10015552-10015574 GCGCGGGCCCCGCCGCCGCCCGG - Exonic
1190008134 X:46759177-46759199 GCGCGCGCCCCTCCCCCGCGCGG - Intergenic
1190717370 X:53115379-53115401 GGGCTGGCCCCCCCGGCCCCAGG - Intergenic
1192274748 X:69616927-69616949 TCGCGCGCGCCCGCGGCCCCTGG + Intronic
1193951777 X:87808925-87808947 CCGCCGGCCCCACCGGCCCCAGG - Intergenic
1194253197 X:91603222-91603244 GCGGGCTCCCCTCTGGCCCAGGG - Intergenic
1195954887 X:110318169-110318191 GCGCGCGCCCCGCCAGCCTCTGG - Exonic
1196918264 X:120561169-120561191 GCGCGAGCTCCCCCGCCCCCCGG - Intronic
1198270517 X:135052051-135052073 GGCCGGGCCCCTCCGGCCCGCGG - Exonic
1198276406 X:135098712-135098734 TAGCGCGCCCCGCCGGCCGCCGG + Intergenic
1198424132 X:136497569-136497591 GCTCGCGCCCCGCCGCCCCCCGG - Intronic
1199393705 X:147309804-147309826 GTGCGCTCCCCTCTGGCCCAGGG - Intergenic
1200068688 X:153517497-153517519 GTGCGCGCCCTTCTGTCCCCAGG - Intergenic
1200173779 X:154097710-154097732 GCGCGCGCGCCGCCGACGCCGGG + Exonic