ID: 1142664742

View in Genome Browser
Species Human (GRCh38)
Location 17:1456174-1456196
Sequence GTCCGCTGGGCGGCGGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142664742_1142664757 30 Left 1142664742 17:1456174-1456196 CCGGCGCCCGCCGCCCAGCGGAC 0: 1
1: 0
2: 2
3: 19
4: 223
Right 1142664757 17:1456227-1456249 CGAAATGGCGGCGGCAGCCGCGG 0: 1
1: 0
2: 2
3: 16
4: 134
1142664742_1142664752 15 Left 1142664742 17:1456174-1456196 CCGGCGCCCGCCGCCCAGCGGAC 0: 1
1: 0
2: 2
3: 19
4: 223
Right 1142664752 17:1456212-1456234 CTTCACAGCAGCGCCCGAAATGG 0: 1
1: 0
2: 0
3: 3
4: 67
1142664742_1142664753 18 Left 1142664742 17:1456174-1456196 CCGGCGCCCGCCGCCCAGCGGAC 0: 1
1: 0
2: 2
3: 19
4: 223
Right 1142664753 17:1456215-1456237 CACAGCAGCGCCCGAAATGGCGG 0: 1
1: 0
2: 2
3: 7
4: 63
1142664742_1142664754 21 Left 1142664742 17:1456174-1456196 CCGGCGCCCGCCGCCCAGCGGAC 0: 1
1: 0
2: 2
3: 19
4: 223
Right 1142664754 17:1456218-1456240 AGCAGCGCCCGAAATGGCGGCGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142664742 Original CRISPR GTCCGCTGGGCGGCGGGCGC CGG (reversed) Exonic
900332937 1:2145278-2145300 GTCAGCTGGGTGGCAGGCTCTGG - Intronic
900410754 1:2511487-2511509 GTCAGCTGGGCTTCGGGGGCGGG - Intronic
901676570 1:10889010-10889032 GGCCCCTGGGCGGCCGGGGCGGG + Intergenic
901836292 1:11926105-11926127 GTCCGGCGCGCGGCGGGCGGCGG - Exonic
902323606 1:15684399-15684421 GAGGGCCGGGCGGCGGGCGCCGG + Exonic
902823255 1:18956264-18956286 GCCCGCCGGGCGGCGGCGGCGGG - Exonic
903072102 1:20731717-20731739 GGCCCCTGAGGGGCGGGCGCGGG + Intronic
903180791 1:21603806-21603828 GTCCGCGGGGCCGCCGGCTCTGG - Intronic
903468372 1:23568136-23568158 GGCCGCCGGGCGCGGGGCGCGGG - Intergenic
904699866 1:32351769-32351791 CTGCGGCGGGCGGCGGGCGCCGG + Intronic
906078377 1:43068329-43068351 GCCCGCGGGGCGCTGGGCGCGGG + Intergenic
906206799 1:43991512-43991534 GTCCGGCGGGCGGCGCGTGCCGG - Intronic
908544129 1:65147913-65147935 GTGCGTGGGGCGGCGGGGGCTGG + Exonic
911176183 1:94820428-94820450 GTGCGCTCGCCGGCGGGGGCCGG - Exonic
911208661 1:95117678-95117700 CTGCGCTTGGCGGCTGGCGCGGG - Intronic
912436853 1:109668162-109668184 GTCCGCTGGGCGGTGGGACGGGG + Intronic
912716873 1:111989527-111989549 GCGCGCGGGGCGCCGGGCGCGGG - Intergenic
915598957 1:156910457-156910479 GAGAGGTGGGCGGCGGGCGCGGG - Intronic
920660569 1:207911052-207911074 GTCCGCAGGGGCGCGCGCGCAGG - Exonic
920676391 1:208041302-208041324 GTCCTCTGGGCAGCAGGGGCTGG - Intronic
920705524 1:208247971-208247993 GTCGGCTGGGAGGTGGGCTCAGG + Intergenic
921525070 1:216207402-216207424 GTCCTCTGGGCGGAGGTTGCTGG + Exonic
922809202 1:228406592-228406614 GTCCGCGGGGCGGCGGCGGGCGG + Exonic
923744263 1:236686312-236686334 GGCCTCTGGGCGGCGGCTGCAGG + Intergenic
923744337 1:236686568-236686590 GGGCGGCGGGCGGCGGGCGCGGG - Exonic
924179162 1:241424113-241424135 GCCCCCAGGGCGGCGGGCTCCGG - Intergenic
924778405 1:247126827-247126849 AGCCGCGGGGCTGCGGGCGCGGG - Intronic
924783253 1:247171593-247171615 AGCCGCGGGGCTGCGGGCGCGGG + Intronic
1065099572 10:22320750-22320772 GGCCGGGGGGCGGCGGCCGCGGG + Intronic
1065186479 10:23174429-23174451 GTGGGCTGGGCGTCGGCCGCGGG + Intergenic
1066464405 10:35640348-35640370 GGCGGCGCGGCGGCGGGCGCGGG - Exonic
1072249007 10:93567164-93567186 GGGTCCTGGGCGGCGGGCGCGGG + Exonic
1075119148 10:119651638-119651660 GCCCGCTGGGGCGCGGGTGCGGG - Exonic
1075801854 10:125159420-125159442 GCGGGCCGGGCGGCGGGCGCGGG - Intronic
1076149255 10:128149797-128149819 GGCCGCTGCGCAGGGGGCGCGGG - Intergenic
1076977908 11:189486-189508 GTCCCCTGGGGGGCGGGGGGAGG + Intronic
1077101292 11:823736-823758 GTCCTCTGGGCCGTGGGGGCGGG - Exonic
1077105983 11:842866-842888 GACAGCTGCGCGGCGGGAGCGGG + Intronic
1077533101 11:3106445-3106467 TTCCGCTGGGTGACGGGTGCAGG - Intronic
1077535385 11:3121685-3121707 GGCCAGTGGGCGGAGGGCGCTGG - Intronic
1078081291 11:8206465-8206487 CTCCTCTGGGCGGAGGGAGCCGG + Intergenic
1082261455 11:50078550-50078572 GGCTGCTGGGAGGCGGGAGCTGG + Intergenic
1083782261 11:64924701-64924723 AGCAGCTGGGCGGCGGGTGCCGG + Exonic
1084265605 11:68003853-68003875 GGCCGGGGGGCGGCGGGCACCGG - Intronic
1090799142 11:130159896-130159918 GCCCGCAGGGCGCGGGGCGCGGG - Exonic
1090830716 11:130419083-130419105 GTGCTCTGGGTGGCGGTCGCTGG + Exonic
1091124624 11:133083225-133083247 GTGCACTGAGCGGCGGGAGCGGG + Intronic
1094470278 12:30796235-30796257 GGCCGCGGGGCGGCGGGGGCGGG - Intergenic
1096143840 12:49264726-49264748 GTCCACTGGGAGGAGGGAGCAGG - Intronic
1096674381 12:53218780-53218802 GCGGGCGGGGCGGCGGGCGCTGG - Intronic
1097232459 12:57520914-57520936 GGCCGTTGGGCGCCGGGAGCTGG - Intronic
1097787827 12:63780177-63780199 GGCTGCTGGGCGGCTGGGGCCGG + Intronic
1101504163 12:105330942-105330964 GTCCGGCGGGAGGCGGGGGCCGG + Intronic
1101773826 12:107775762-107775784 GCGCGCTGTGCGGCGGGCGCGGG - Exonic
1101940754 12:109097749-109097771 GTCCCCTGGACGGCCGGCTCGGG - Exonic
1103488228 12:121296858-121296880 GGGCGGTGCGCGGCGGGCGCGGG - Intronic
1103978027 12:124716485-124716507 GTTAGCAGGGCGGCTGGCGCTGG + Intergenic
1104718960 12:131034041-131034063 GGCGGCTGGGAGGCTGGCGCTGG - Intronic
1104727139 12:131084996-131085018 GCCTGCTGGGAGCCGGGCGCTGG + Intronic
1106077868 13:26476310-26476332 GTCCGCAGGGCGGCGGTCAGGGG + Intergenic
1106247309 13:27961069-27961091 GTCCGCTGGGCGAGGGGTCCTGG - Intergenic
1107364540 13:39656017-39656039 CTCCGCTGCTCTGCGGGCGCCGG + Intronic
1107604057 13:42040911-42040933 CCACGCTGGGCTGCGGGCGCCGG - Intronic
1108196569 13:48001286-48001308 GTCCCCTCGGCGCCGCGCGCAGG + Exonic
1111518298 13:89363478-89363500 GTCCGCGGGCAGGTGGGCGCCGG + Intergenic
1111676787 13:91398565-91398587 GTCCGCGGGGCGGGGAGTGCGGG + Intergenic
1112520363 13:100089280-100089302 CGCCTCTGGGCGGCTGGCGCCGG + Intronic
1114674176 14:24430038-24430060 GTCCCCTGGGCTGGGGGCGCGGG + Intronic
1115203121 14:30874597-30874619 GAGCCCCGGGCGGCGGGCGCGGG + Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1120167880 14:81220308-81220330 GAGCGCCGGGCGGCGGGCGCGGG - Intronic
1120765440 14:88323562-88323584 GCCCGCGGGGCGGCGGGAGGCGG + Intronic
1121368192 14:93333229-93333251 GTCGGCTGGGAGCCGGGCGTCGG + Exonic
1121617024 14:95320008-95320030 GAGCGCGGGGCGGCGGGTGCGGG + Intergenic
1121754482 14:96391809-96391831 GTGGGCTGGGCGGGGCGCGCCGG - Intergenic
1122418215 14:101560494-101560516 GGGCGCGGGGCAGCGGGCGCGGG - Intergenic
1122582335 14:102778170-102778192 GACCGCTTGGCGGGCGGCGCGGG + Intronic
1122878103 14:104678065-104678087 GTCCGCTGGGCTGGGGGCTCCGG - Intergenic
1122975301 14:105168459-105168481 GGCGGCTGGGAGCCGGGCGCGGG - Exonic
1129440636 15:75578780-75578802 GTCCGCCCGGCGGCGGTGGCGGG - Exonic
1129676552 15:77634897-77634919 ACCCGCTGGGGGGCGGGGGCGGG + Intronic
1132326386 15:100973633-100973655 GGTCGCGGGGCGGCGAGCGCAGG + Intronic
1132851472 16:2026807-2026829 GGCGGCCGGGCGGCGGGGGCGGG + Intronic
1133868555 16:9667028-9667050 GTCTGCTGGGCGGCTGGCGGAGG - Exonic
1134614840 16:15643113-15643135 GTGCGCTTGGCGGCGGCGGCGGG - Exonic
1137559290 16:49492632-49492654 ATCTGCTGGGAGGCAGGCGCGGG - Intronic
1139341480 16:66270563-66270585 GTTCGCTGGGAGGCCGGCGGCGG + Intergenic
1139528100 16:67528786-67528808 GGCGGCGGGGCGGCGGGCGGAGG + Intronic
1141231341 16:82170352-82170374 GCTCGCGGGGTGGCGGGCGCGGG + Intergenic
1142400922 16:89858435-89858457 GCACGCGGGGCCGCGGGCGCTGG - Exonic
1142465330 17:133951-133973 GTCCCCTGGGGGGCGGGGGGAGG + Intergenic
1142664742 17:1456174-1456196 GTCCGCTGGGCGGCGGGCGCCGG - Exonic
1142852604 17:2711517-2711539 GGCCGCTGGGCGGGGGGCGCCGG - Intronic
1143018589 17:3904612-3904634 GTCAGCTGGGCGGTGGGGGTGGG + Intronic
1143411862 17:6713876-6713898 GCCCGCGGTGCGGAGGGCGCGGG - Intergenic
1145009979 17:19362464-19362486 GGACGCTGGGGGGCGGGCCCCGG + Intronic
1146022635 17:29292894-29292916 GGCCGCGGTGCGGGGGGCGCCGG + Intronic
1146281846 17:31549893-31549915 GTCCCGCAGGCGGCGGGCGCGGG + Intergenic
1146445250 17:32928005-32928027 GGCAGCTGGGAGGCGGGCCCTGG - Exonic
1147313484 17:39607852-39607874 CTCCTCAAGGCGGCGGGCGCCGG + Exonic
1147987032 17:44312702-44312724 GACCGCTGGGGGAGGGGCGCTGG - Intronic
1147987060 17:44312760-44312782 GACCGCTGGGGGAGGGGCGCTGG - Intronic
1148386564 17:47238551-47238573 GCCCCCAGGGCGGCGGGCTCTGG + Intergenic
1149475905 17:56960728-56960750 GCCGGGTGGGCGGCGGGCGGGGG - Intronic
1150790203 17:68196779-68196801 GTCGCCTGGGCGGTGGACGCAGG + Intergenic
1151674351 17:75589960-75589982 GTGCGCTGGGCGCAGGGCTCAGG + Intergenic
1151763801 17:76121998-76122020 CTGCGCTGGGCAGCGGGTGCGGG + Intergenic
1152617832 17:81346025-81346047 GGCCGCGGGGCGCGGGGCGCTGG - Intergenic
1152722036 17:81927979-81928001 GGGCCCTGGACGGCGGGCGCAGG - Intergenic
1153515278 18:5895739-5895761 GGCCGCGGGGCAGGGGGCGCGGG + Intronic
1153805468 18:8705868-8705890 GAGCGCGGGGCGGCGGGAGCCGG - Intronic
1154070571 18:11148829-11148851 GGCCGCAGGGGGCCGGGCGCCGG - Intergenic
1155928941 18:31685573-31685595 GGCCCCGGTGCGGCGGGCGCGGG - Intronic
1157611078 18:48956058-48956080 GTCCTCTGGGCGGCAGTGGCCGG - Intergenic
1159021234 18:63144874-63144896 GTGCCCAGGGCGGCGGGGGCGGG - Intronic
1160653461 19:246732-246754 CGCCGCTGGGCGGGGAGCGCGGG + Intergenic
1160678268 19:401758-401780 GTCAGCTGGGAGGTGTGCGCAGG + Intergenic
1160739648 19:680034-680056 CTGCGCTGGGGGGCGGGGGCTGG - Intronic
1160745378 19:708932-708954 GTCCGGGCGGCGGCGGGCGCGGG - Intergenic
1160851408 19:1194664-1194686 GGCCGCCAGGTGGCGGGCGCGGG - Intronic
1161076913 19:2290260-2290282 GTCCGGTTGGCGGCCGGCTCGGG + Exonic
1165157531 19:33797107-33797129 CTCTGCTGGGCGGCGGGGGCTGG + Intronic
1165934948 19:39383556-39383578 GCTCCCTGGGCGGCGGGCGGGGG + Exonic
1166888250 19:45973941-45973963 GCCCGGGGGGCGGCGGGCGCGGG + Intergenic
1167703780 19:51066273-51066295 GTCCGGTGGTTGGCGGGAGCAGG - Intergenic
1167738686 19:51311715-51311737 GCCCGGGGGGCGGCGGGGGCGGG - Intergenic
1168098375 19:54128251-54128273 GTCGGCTGGGAGGAGGACGCCGG - Intronic
1168297303 19:55383739-55383761 GGGCCCGGGGCGGCGGGCGCGGG - Exonic
1168536056 19:57171983-57172005 GTCCGGGGGGCGGGGGCCGCGGG + Intergenic
1168719109 19:58545070-58545092 GACGGCGGGGCGGCGGGCGACGG + Exonic
927900621 2:26815766-26815788 GGCCGCCGGGTGGGGGGCGCCGG + Intergenic
929242270 2:39665662-39665684 GTGCGCGGGGTGGGGGGCGCCGG + Intronic
929777716 2:44939065-44939087 GGCGGCAGGGCGGCAGGCGCTGG + Intergenic
930136361 2:47906544-47906566 GGCCGCGGGGCGGCGGGGGGAGG + Intergenic
931253363 2:60551767-60551789 GGCGGGTGGGCGCCGGGCGCCGG + Intronic
932621854 2:73269407-73269429 GCCAGCAGGGCGGCGGGCTCGGG + Exonic
934477476 2:94603073-94603095 GTGCGCTGGGCCGCGTGCCCTGG + Exonic
934933184 2:98445046-98445068 GACAGCGGGGCGGCTGGCGCCGG + Exonic
934966813 2:98730973-98730995 GGCGGCTGCGCGGAGGGCGCGGG - Intronic
934993326 2:98936341-98936363 GACCTCGGGGCGGGGGGCGCAGG + Intergenic
935692667 2:105745015-105745037 GTCCGCCCGGCGGCGGGAGGAGG + Exonic
936384838 2:112020169-112020191 GTCGGCTGGGAGGCGGGAGGGGG - Intronic
937183088 2:120013305-120013327 GTCCCCGGGGAGGCGGGCGGGGG + Intronic
937913993 2:127090015-127090037 GTGCACTGGGCGGCAGGTGCGGG - Intronic
940293442 2:152099041-152099063 GTGCGGTGGGCGGAGGGGGCTGG + Exonic
942240922 2:173964096-173964118 GTCCGCGGGCAGGCGGGCGGCGG + Intronic
944070021 2:195657650-195657672 GACCGCTGGGCGGGTGGCGGCGG + Intronic
945033709 2:205686571-205686593 AGCGGCTGGGTGGCGGGCGCCGG + Intronic
946239466 2:218344987-218345009 GTGGGCTGGGCTGGGGGCGCTGG - Exonic
947640748 2:231706643-231706665 GACCGCTGGGCAGCGGGTGTTGG + Intergenic
948822656 2:240557806-240557828 CTCCGTGGGGCGGCGGGTGCGGG - Intronic
1169130591 20:3164702-3164724 GGCGGCTGAGCGGCGGGCCCGGG - Exonic
1169673818 20:8132574-8132596 GTGCGCGGGGCGCGGGGCGCGGG - Intronic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1172428576 20:34872691-34872713 CTCAGCGGGGCCGCGGGCGCCGG + Exonic
1172702670 20:36862839-36862861 GGCTGCTGCGCGGAGGGCGCGGG + Exonic
1174873978 20:54208173-54208195 GGCCGCTGGGGCCCGGGCGCGGG + Intronic
1175367685 20:58467108-58467130 GTGCGCTCTGCAGCGGGCGCTGG + Exonic
1176549769 21:8216118-8216140 GTCCGCGGGGCTCCGGGGGCGGG - Intergenic
1176557660 21:8260347-8260369 GTCCGCGGGGCTCCGGGGGCGGG - Intergenic
1176568694 21:8399152-8399174 GTCCGCGGGGCTCCGGGGGCGGG - Intergenic
1176576608 21:8443387-8443409 GTCCGCGGGGCTCCGGGGGCGGG - Intergenic
1176856829 21:13980843-13980865 GTCCACGGGGCGGGGGGTGCGGG - Intergenic
1179799636 21:43804877-43804899 CTCAGCTGGGCGGCCGGGGCAGG + Exonic
1179974350 21:44855678-44855700 GTCAGGTTGGCGGCGGGCGAGGG - Intronic
1180614885 22:17120655-17120677 AGCCGCTCGGCGGGGGGCGCGGG - Exonic
1185255214 22:49827786-49827808 GGGCGGCGGGCGGCGGGCGCGGG + Intergenic
1185388386 22:50546877-50546899 GGCCCCTGGCAGGCGGGCGCGGG + Intergenic
1203254658 22_KI270733v1_random:132444-132466 GTCCGCGGGGCTCCGGGGGCGGG - Intergenic
1203262714 22_KI270733v1_random:177523-177545 GTCCGCGGGGCTCCGGGGGCGGG - Intergenic
950487829 3:13283173-13283195 GTCCGCGGGGCAGCGGGCGGCGG - Intergenic
950718332 3:14865187-14865209 GTCTGCTGGGAAGCGGGCGAAGG - Intronic
953326106 3:42013712-42013734 GGCCCCGGGGCGGCGGGCGGGGG - Intergenic
953908927 3:46882302-46882324 GGCGGCCGGGCGGGGGGCGCTGG + Intronic
961081739 3:124033653-124033675 GCCCGGTGGGCGGAGGGCGCGGG - Intergenic
966808732 3:183825555-183825577 GGGAGCGGGGCGGCGGGCGCCGG - Exonic
968088486 3:195885378-195885400 GTCTGCGGGGTGGCGGGTGCAGG - Intronic
968511353 4:997291-997313 GCCCGCTGGGCTGGGGGCGCGGG - Intronic
968820007 4:2843498-2843520 GTGCGCTGGGCGGCGGCGGGAGG + Intergenic
968948943 4:3680270-3680292 GTTCGCTGGGCTGGGGGTGCGGG + Intergenic
969559552 4:7938874-7938896 CTCCCCTGGCCGGCGGGCCCCGG - Intronic
971405624 4:26319477-26319499 GGGCGGCGGGCGGCGGGCGCGGG - Intronic
978351471 4:107824857-107824879 GCGCGCTGGGCGCAGGGCGCAGG + Intronic
984735054 4:183099971-183099993 GGCCTCTGGGCGGCGGGGGTGGG + Intronic
985068419 4:186144913-186144935 GCCAGCCGCGCGGCGGGCGCGGG + Exonic
985902321 5:2806252-2806274 GTTCGCTGGGCTGCTGGCACTGG + Intergenic
989983117 5:50666703-50666725 ACCGGCTGGGCGGCGGGCGCCGG - Intronic
996378968 5:122845273-122845295 GTCCGCAGGGCAGGGAGCGCCGG + Intronic
996698383 5:126423472-126423494 ATGCGCTGGGCGGAGGGTGCAGG + Intronic
1000071500 5:157744263-157744285 GTCTGCGGGGCGGCGGTGGCCGG + Intronic
1002131947 5:177087181-177087203 GTCCGCCGGGCGGCAGGGGGTGG + Intronic
1002925860 6:1605315-1605337 GTGCGCGGTGCGGCGGGAGCCGG - Intergenic
1002927180 6:1611328-1611350 GGCGGCGGGGCGGAGGGCGCGGG - Exonic
1002929185 6:1621524-1621546 GTCCGCTTGGCCGCGGGCGCTGG - Intergenic
1004627885 6:17393806-17393828 GGGCGCCTGGCGGCGGGCGCTGG + Intronic
1006717679 6:36130714-36130736 GGCCGCTGGGGGGCGGGGGGCGG + Intronic
1007363284 6:41373395-41373417 GACCGCTGGGGGGAGGGGGCAGG - Intergenic
1010628093 6:78163272-78163294 GCCCGCGTGGTGGCGGGCGCAGG + Intergenic
1013272863 6:108559618-108559640 CTCCGCGGGGCTGCGGGCGTGGG - Intergenic
1013507572 6:110815262-110815284 GACCGCGGAGCGGCGGGCGGCGG - Exonic
1015910171 6:138161840-138161862 CTCCGCTCGGCGGCGGCTGCGGG - Intergenic
1018876533 6:167826886-167826908 GGGCGGCGGGCGGCGGGCGCCGG + Intergenic
1019258257 7:65267-65289 GGCCGCTGGGCCCCGGGTGCTGG + Intergenic
1019303695 7:322387-322409 GTCTGCGGGGCGGCGGGGGCGGG - Intergenic
1019364770 7:627707-627729 GTGAGCTGGGCGGGGGGCTCTGG - Intronic
1019712359 7:2523547-2523569 GTGCGCCGGGCGGCACGCGCTGG + Intronic
1019828195 7:3301148-3301170 GGGCGGCGGGCGGCGGGCGCGGG + Intergenic
1024578297 7:50782379-50782401 GGGCGCTGGGCGGTGGGCGGTGG - Intronic
1025976758 7:66376642-66376664 GGCCGCCGGGAGGCGGGAGCTGG + Intronic
1026446232 7:70487226-70487248 GTTGGCTGGGAGGGGGGCGCGGG - Intronic
1032051763 7:128654376-128654398 GGCCGCTGGGAGGCCGGAGCTGG - Intergenic
1032130713 7:129225233-129225255 GGCCGCTCCGCGGCGGGAGCTGG - Exonic
1033589381 7:142797176-142797198 GGCTGCTGGGGCGCGGGCGCGGG + Intergenic
1034197875 7:149262076-149262098 GGGCGCGGGGCGGCGGCCGCGGG + Intergenic
1034335913 7:150323431-150323453 GGCCGCCAGGCGGCGGGCGGCGG + Exonic
1037884468 8:22589110-22589132 GCCCGCTGGTCGGCGAGGGCTGG + Intronic
1037884491 8:22589171-22589193 GTCCGCTGGTCGGCGAGGGCCGG + Intronic
1039542361 8:38382397-38382419 GTCGGCGGGGCGGAGGGGGCGGG + Intergenic
1039921681 8:41897528-41897550 GTCCCCAGGGAGGCGTGCGCGGG - Intergenic
1040307712 8:46220798-46220820 GTCCGCTGGGTGGCGTGGGAGGG + Intergenic
1040333332 8:46403510-46403532 GGCCGCTGGGTGGCGTGGGCGGG + Intergenic
1041167257 8:55102315-55102337 GCCCGGCGGGCGGCGGGCGGCGG + Intergenic
1048009343 8:130443553-130443575 GCCGGCTGGGCGGGAGGCGCGGG + Exonic
1049454245 8:142678946-142678968 GTCAGCTGGGCGGTGGGTGGTGG - Intronic
1049707365 8:144049146-144049168 GGCCGCGGGGCGTCGGTCGCCGG - Intergenic
1052852493 9:33386483-33386505 GTGCGCTGGGCCGCGTGCCCTGG - Exonic
1053151998 9:35749290-35749312 GTCCGCTGGGCGGTAGAGGCGGG - Exonic
1053230221 9:36401306-36401328 GTCCGCAGGGCAGCGGGGGGCGG - Intronic
1053732823 9:41074590-41074612 GTCCCCAGGCGGGCGGGCGCAGG - Intergenic
1054835550 9:69672169-69672191 GTCCGCGGGCCCGCGGGAGCAGG + Exonic
1057600163 9:96450574-96450596 GGCCGCTGAGCGACGGGCGCCGG - Exonic
1057869679 9:98708578-98708600 GGCTGCTGGGCGGCGGCCGGGGG + Exonic
1060893488 9:127202900-127202922 GGCCGCAGGGCAGCGGCCGCAGG + Intronic
1060979809 9:127785668-127785690 CTGCGCGGGGCGGCGGGCGGGGG - Intronic
1061825579 9:133256425-133256447 GGCCGCTGGCGGGCGGGTGCAGG - Intronic
1062036842 9:134386249-134386271 GGCCGCTGGCCGGCGGGCTCAGG - Intronic
1062448648 9:136606388-136606410 GTCTGCAGGGCGGAGGGAGCTGG - Intergenic
1062556356 9:137114872-137114894 GACCCCTGGGCAGCGGCCGCGGG - Intronic
1062698043 9:137885347-137885369 GTCTGCTGTGCGGCGAGTGCTGG + Intronic
1203471059 Un_GL000220v1:115589-115611 GTCCGCGGGGCTCCGGGGGCGGG - Intergenic
1203478880 Un_GL000220v1:159561-159583 GTCCGCGGGGCTCCGGGGGCGGG - Intergenic
1189147177 X:38667123-38667145 GTCCTCTGGGTGGCAGGCTCTGG - Intronic
1198302402 X:135344867-135344889 GTTCCCTGGGGCGCGGGCGCGGG + Intronic
1198302424 X:135344942-135344964 GTGCCCCGGGCGGCGGGCGCCGG + Intronic
1199772507 X:150983773-150983795 GGGCGCTGGGCGGCGGCAGCGGG + Intronic