ID: 1142668018

View in Genome Browser
Species Human (GRCh38)
Location 17:1473491-1473513
Sequence GGGCACAGTGAGCCACACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668018 Original CRISPR GGGCACAGTGAGCCACACCC TGG Intronic
900289347 1:1917297-1917319 TGGGACAGTGAGGCACACACAGG - Intergenic
900678789 1:3904596-3904618 GGGCACAGTGAGACTCCCCATGG + Intergenic
900686769 1:3953822-3953844 GTGCCCAGTGAGCCATTCCCAGG + Intergenic
901134208 1:6982649-6982671 GGGGACAGGGAGCCAGAACCCGG - Intronic
901562680 1:10085202-10085224 GTGGACTGAGAGCCACACCCTGG + Intronic
903352639 1:22727235-22727257 GGGCAGAAATAGCCACACCCAGG - Intronic
903482048 1:23660896-23660918 GGGCACCGTGGCTCACACCCAGG - Intergenic
903808879 1:26023394-26023416 GGGCGCTGTGAGCAAGACCCTGG + Exonic
903942476 1:26941398-26941420 GGGGACAGTGTCCCACAGCCTGG - Intronic
906000093 1:42417374-42417396 GGGCTCTGTGAGCCTCAGCCAGG + Exonic
907291121 1:53413632-53413654 GGGTACAGTGAGGCAAAGCCCGG + Intergenic
907506832 1:54925130-54925152 GGGGACCCTGAGCCACACCAAGG - Intergenic
912489029 1:110051132-110051154 AGGCACAGTGAGCCCCACCCTGG - Intronic
915891688 1:159779688-159779710 GGACACAGTGATCCAAGCCCAGG - Intergenic
918349260 1:183636272-183636294 AGGCAGAGTGATGCACACCCGGG + Exonic
920003130 1:202812672-202812694 GGGCAAAGTTAGCCACACCAGGG + Intergenic
920375045 1:205503797-205503819 GGGCACAGTGCCCCACCGCCAGG - Intergenic
922112800 1:222578448-222578470 GGGCCCTGTGTGCCATACCCAGG - Intronic
922617713 1:226972963-226972985 GGCCACAGCAAGCCACAGCCAGG - Intronic
922698301 1:227743003-227743025 GGGCCCAGTGGGCCATACACAGG - Intronic
923461826 1:234214964-234214986 AGGCACAGAGCTCCACACCCAGG - Intronic
1062981222 10:1724620-1724642 TGCCTCAGTGAGCCACAGCCTGG + Intronic
1064973296 10:21088182-21088204 GGACACAGTGTACCACATCCTGG + Intronic
1069697053 10:70394210-70394232 AGTCACACTGAGCCACCCCCAGG - Intergenic
1069905575 10:71730392-71730414 GGCCACAGTGGGCCAAGCCCTGG + Intronic
1069907411 10:71739933-71739955 GAGCACAGTGAGGCTGACCCAGG + Intronic
1074002815 10:109389462-109389484 GGGCAGAAGAAGCCACACCCAGG + Intergenic
1075699166 10:124457609-124457631 GGGCACAGTGGCTCACACCTTGG - Intergenic
1076701373 10:132275036-132275058 GGACACCGTGAACCACACACTGG - Intronic
1076869976 10:133188434-133188456 GGGCTGAGTGGGCCTCACCCTGG + Intronic
1077176813 11:1194873-1194895 GGGGACAGTGAGGCACAGGCAGG + Intronic
1077315697 11:1918476-1918498 GGGCACTGTGAGCCCCTGCCGGG + Intergenic
1077400224 11:2351972-2351994 GGGCAGCCTGAGCCACACCTGGG + Intergenic
1080425922 11:32154201-32154223 GAGCACACTGAGCCATTCCCAGG + Intergenic
1080628420 11:34051865-34051887 GCGCACGGTGAGCGCCACCCGGG + Exonic
1083442704 11:62687749-62687771 GGGCACAGACAGCCCCACCTGGG - Exonic
1083764680 11:64836161-64836183 GGCCACAGCTAGCCAGACCCGGG - Exonic
1083868303 11:65470813-65470835 GGGCCCTGTTAGCCACACACCGG + Intergenic
1084180025 11:67441572-67441594 GGGCAGAGTGGGCCTCAGCCTGG - Intronic
1084856071 11:71987505-71987527 GGGCACAGTTTGCCAACCCCTGG - Intronic
1086135239 11:83438025-83438047 GGACACTGTAAGCCACAACCTGG - Intergenic
1088645431 11:111913153-111913175 GGGGACAAGGAGGCACACCCAGG - Intronic
1089136036 11:116250063-116250085 GGGGACAGTGTGCCCCATCCTGG - Intergenic
1089351434 11:117823769-117823791 GGGCACAGTTTGGCACAGCCCGG - Intronic
1089609079 11:119659522-119659544 GGGCAGAAGGAGCCACAGCCTGG + Intronic
1090423319 11:126590531-126590553 GTCCACAGTGAGCCACAGCAGGG - Intronic
1091621539 12:2092987-2093009 GGAGGCAGTGAGCCACAGCCTGG + Intronic
1094040074 12:26113370-26113392 TGGCACAGTGAGTGCCACCCTGG - Intergenic
1094488390 12:30942968-30942990 TGGCACAGTGAGGCACAGGCTGG - Intronic
1096627523 12:52904625-52904647 GGGCACAGTCAGCCACGCAGGGG + Intronic
1096712769 12:53469802-53469824 GGTCACAGTGAGCCAAGCCTGGG - Intronic
1097996231 12:65890862-65890884 GGGCACGGTGATGCACACCAGGG - Intronic
1100206456 12:92354863-92354885 GGGAACAGTCAGGCCCACCCAGG + Intergenic
1102347149 12:112167566-112167588 GGGCACAGAGGCCCACGCCCAGG - Intronic
1102579070 12:113874567-113874589 TGGCACACTGTGCCCCACCCTGG + Intronic
1106546513 13:30735394-30735416 GGACACACTGAACCACAGCCAGG + Intronic
1106949743 13:34870143-34870165 TGTCACAGTGTGCAACACCCTGG + Intergenic
1107805736 13:44152299-44152321 GGGCATAGAGAGCCTCACTCTGG - Intronic
1108530799 13:51325304-51325326 GGGCTGAGTGAGCCAAGCCCTGG - Intergenic
1109554011 13:63946448-63946470 AGGCATACTCAGCCACACCCAGG - Intergenic
1113267746 13:108638178-108638200 GGGAACAGTGTGCCACACAGAGG + Intronic
1113752368 13:112785180-112785202 GGACACAGGGAGCCACCTCCGGG + Exonic
1113878228 13:113607864-113607886 GGGCAGAGTGAGAAACATCCAGG + Intronic
1121411076 14:93748618-93748640 GGGCACAGAGCCCCTCACCCAGG - Intronic
1122124159 14:99570289-99570311 GGCCACTGTGAGCCAGGCCCTGG + Intronic
1122282651 14:100633207-100633229 GGGCACAGAGAGACACACACTGG - Intergenic
1124621495 15:31276610-31276632 GACCACAGTGAGCCAGACTCGGG + Intergenic
1125557047 15:40594538-40594560 GGGCACAGTGTGCCCGGCCCGGG - Intronic
1127389459 15:58493419-58493441 GTGCATAGTGAGCCAAACTCGGG - Intronic
1128158920 15:65410322-65410344 GGGGACAGTGAGACACAGGCAGG + Intronic
1128546622 15:68572905-68572927 GGGCACAGTGAGGAAACCCCAGG - Intergenic
1129382666 15:75177971-75177993 GGCCCCAGTGAGCCAGGCCCTGG + Intergenic
1129456270 15:75677502-75677524 GGGAACCCTGAGCCCCACCCTGG - Intronic
1129975145 15:79815688-79815710 GGGCACAGCGTGCCAGGCCCTGG + Intergenic
1130112555 15:80977710-80977732 GGGGAGAGAGCGCCACACCCTGG - Exonic
1130642022 15:85685757-85685779 GGGCACGGTGGATCACACCCAGG - Intronic
1133913941 16:10091588-10091610 GGCTGCAGTGAGCCACAGCCTGG + Intronic
1135607894 16:23838547-23838569 GGGCAAAGTGACCACCACCCTGG + Intronic
1137631183 16:49946703-49946725 GGGCTCAGTGACTAACACCCAGG + Intergenic
1138521212 16:57572052-57572074 GGGCAGAGTGAGGAAGACCCAGG - Intronic
1139469430 16:67170421-67170443 GGGCACTAGGAGCCACACCGCGG - Intronic
1139641775 16:68296806-68296828 GGGCACAGAGAAGCTCACCCAGG - Exonic
1139884464 16:70198565-70198587 GGACACAGTGAGGAACCCCCTGG - Intergenic
1140368053 16:74396926-74396948 GGACACAGTGAGGAACCCCCTGG + Intergenic
1141508500 16:84496728-84496750 GGCCAAAGTGAGCTACACCCAGG - Intronic
1141948071 16:87323804-87323826 GGGCAAGGTGAGCCACAGGCTGG + Intronic
1142668018 17:1473491-1473513 GGGCACAGTGAGCCACACCCTGG + Intronic
1145018951 17:19415415-19415437 GGGCACACAGACCCCCACCCCGG - Intronic
1147946763 17:44084747-44084769 GGGCACACAGAGCCACTTCCTGG + Intronic
1150496035 17:65608432-65608454 GGGCACAGTGCCTCTCACCCTGG - Intronic
1151361630 17:73592719-73592741 CGGAACAGTCAGGCACACCCTGG + Intronic
1151434779 17:74088310-74088332 GGGCACAGTGTGTCACAGGCAGG - Intergenic
1151755880 17:76074997-76075019 GGGCACCGTGGGCAACACGCTGG + Exonic
1152266459 17:79297623-79297645 GGGCACAGTGTGCCTTTCCCAGG + Intronic
1152560502 17:81076302-81076324 GAGCTCAGTGAGCCCCTCCCAGG - Intronic
1152835861 17:82530789-82530811 GGGCACAGTGACTCACACTTTGG - Intronic
1152881083 17:82815610-82815632 GGGCACTGCCAGCCACACCCAGG - Intronic
1153479355 18:5531445-5531467 GGGCACAGTGGTTCACACCTGGG + Intronic
1155561340 18:27080670-27080692 TGGAAAAGTGAGCCACACACTGG + Intronic
1157536792 18:48465381-48465403 GGGCACAGTGAGACTCATGCAGG - Intergenic
1157802622 18:50633323-50633345 GGGCACAGTGGCTCACTCCCAGG - Intronic
1159094991 18:63892131-63892153 GGGTATAGTGAGCACCACCCTGG - Intronic
1159500214 18:69259104-69259126 GTTCACAGTGAGCCACATCTAGG - Intergenic
1161071221 19:2262278-2262300 GGGCACAGTGGCTCACACCTGGG + Intronic
1161362637 19:3859602-3859624 GTGCAGCGTGAGCCACACCCAGG + Intronic
1162126415 19:8502012-8502034 GGGGAAAGTGAGGCACACGCAGG - Intronic
1162371826 19:10284371-10284393 GCACACAGTGAGCCCCGCCCCGG - Intronic
1162894858 19:13759188-13759210 GCCCACACTGAGCCACATCCAGG + Exonic
1164597469 19:29539688-29539710 GGGCACAGTGAGCCACGGAAAGG - Intronic
1164987427 19:32658666-32658688 GGGCACAGTTAGCCACAGGCGGG + Intronic
1166043261 19:40215454-40215476 GGGCACAGGGCTCCACCCCCTGG - Exonic
1167503848 19:49861377-49861399 GGGAACAGTGAGGGACAGCCTGG + Intronic
925539932 2:4956086-4956108 GGGAACAGTGAGAACCACCCTGG + Intergenic
925548448 2:5042766-5042788 GGGCACATTGATGCACAACCTGG - Intergenic
925746118 2:7045219-7045241 GGGCACAGTGTGCCGAACTCAGG + Intronic
926116759 2:10218266-10218288 GGGCACAGGGAGCCAGAACCTGG - Intergenic
926273571 2:11386460-11386482 GAGCACTGCCAGCCACACCCCGG + Intergenic
926309179 2:11662162-11662184 GGTCACAGTGAGCCACCTGCTGG - Exonic
927173080 2:20386804-20386826 GGGGGCAGTGAGGCACAGCCAGG - Intergenic
927843395 2:26459024-26459046 TGGCACAGTGAGCCAGTGCCTGG + Intronic
927899163 2:26806488-26806510 GGGCTCGGAGGGCCACACCCAGG + Intergenic
928904838 2:36357038-36357060 TGGCACCGTGAGCCGCACGCCGG + Intronic
932275713 2:70450890-70450912 AAGCACTGTGGGCCACACCCTGG + Intronic
934718079 2:96554687-96554709 GGGCCCAGTGCCCCACAGCCCGG + Intergenic
935181195 2:100692572-100692594 GGTCACAGTGAGTCACATCCTGG - Intergenic
935634447 2:105238961-105238983 GAGCACAGCTAGCCACACCATGG + Intergenic
937298426 2:120823746-120823768 GGGCAGATGGAGCCACTCCCTGG + Intronic
938264216 2:129914671-129914693 GGGCACAGTGACAGACACACAGG + Intergenic
938264242 2:129914845-129914867 GGGCACAGTGACAGACACACAGG + Intergenic
939118566 2:138089246-138089268 CGGCACAGTGTGCCAGACCCGGG + Intergenic
944524939 2:200609374-200609396 GGGTACAGTTACCCACAGCCAGG - Exonic
945336584 2:208599715-208599737 GGGCACAGTTGTCCAGACCCTGG - Intronic
948747264 2:240105840-240105862 GGTCTCAGTGAGCATCACCCTGG - Intergenic
1168769993 20:408604-408626 GGGGACAGCGAGGCACACACAGG + Exonic
1170469699 20:16656014-16656036 GTGCACATTCAGCCAAACCCTGG + Intergenic
1170973451 20:21138612-21138634 GGTCAAAGTCAGCCTCACCCAGG - Intronic
1171190671 20:23156934-23156956 GGGCACTATGTGCCACAGCCGGG - Intergenic
1171205247 20:23273980-23274002 GGGCACAGTGGGCCCAAGCCTGG + Intergenic
1172777927 20:37417988-37418010 GGGCACTGTGACACACACACAGG - Intergenic
1173210717 20:41029339-41029361 GCGCAGGGTGAGCCAGACCCCGG + Intronic
1175694452 20:61090950-61090972 GGGGGCAGTGAGCCACGACCAGG + Intergenic
1175731192 20:61354870-61354892 GGGCACAGGGAGCCTCTCTCTGG + Intronic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1178065851 21:28903573-28903595 GGGCCCAGTCAGCCAGAGCCCGG - Intergenic
1179632742 21:42688733-42688755 AGGCACAGTGAGCCCCACTCTGG - Intronic
1180054415 21:45349846-45349868 GGGCACGGTGGGCCCCACTCTGG + Intergenic
1181467997 22:23120615-23120637 GGGCTCAGAGAGGCAGACCCAGG + Intronic
1182397181 22:30045184-30045206 CTGCACAGGGACCCACACCCAGG - Intergenic
1183090306 22:35517989-35518011 TAGCACAGTGAACAACACCCTGG + Intergenic
1183617459 22:38954340-38954362 GGGGACAGAGGGCCCCACCCTGG + Intronic
1183907493 22:41052972-41052994 AGGCACAGTGAGCCACTCTTAGG + Intergenic
1184401790 22:44278774-44278796 GGCCACAGTCAGCCACATCCAGG + Intronic
1184830163 22:46980456-46980478 GGGCACAGTGGCTCACACCTGGG - Intronic
1185018009 22:48356949-48356971 GGGCTGAGGGAGCCACACCCAGG + Intergenic
1185058828 22:48595005-48595027 GGGCACATAGAGCCCCAGCCAGG + Intronic
949935616 3:9113401-9113423 GGGCACAGAGACCAACACACAGG - Intronic
950333315 3:12174398-12174420 GGGCACAGTGAGCAACAGTTAGG - Intronic
950831218 3:15878087-15878109 GGGCACAGTGAGCCCATCCCTGG - Intergenic
953377242 3:42438995-42439017 GGGGACAGAGAGCCACCTCCAGG + Intergenic
954083241 3:48224620-48224642 GGGGACAGTGACCCTCAACCAGG + Exonic
954273984 3:49530841-49530863 GGACTCACAGAGCCACACCCTGG + Exonic
954394891 3:50288279-50288301 GGGGACAGAGAGTGACACCCTGG + Intronic
954708051 3:52491567-52491589 GGGCACAGAGAGCCACCCTGGGG - Intronic
954753173 3:52824963-52824985 GGCCAGAGTGAGACCCACCCAGG + Intronic
957820029 3:85360848-85360870 GGTCTCACTGAGCCACTCCCTGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961168793 3:124781196-124781218 GGCCACAGTGAGCCCATCCCGGG - Intronic
962375190 3:134853254-134853276 AGGCCCTGTGAGCCACACCGGGG - Intronic
968086323 3:195875570-195875592 GGCCACACTGAGCCTCACACGGG - Intronic
968470437 4:779584-779606 GAGGAGGGTGAGCCACACCCAGG - Intergenic
969511697 4:7621737-7621759 GTGGACAGTGTGCCACACCCCGG - Intronic
972778593 4:42266009-42266031 GGGCTCAGTGGGCCCCACACTGG + Intergenic
976420995 4:84843680-84843702 GGGCACAGTAGCTCACACCCAGG - Intronic
978402052 4:108341527-108341549 GGGCTCGGTGCACCACACCCAGG - Intergenic
980836708 4:138202851-138202873 AGGCACAGTGAGCATCACACTGG - Intronic
982230600 4:153205250-153205272 GGGCTCAGCCAGCCACACCTCGG + Intronic
985570338 5:641289-641311 GTGGTCAGAGAGCCACACCCAGG + Intronic
985716541 5:1466372-1466394 GGGGGATGTGAGCCACACCCCGG + Intronic
986740811 5:10703778-10703800 GGGCACAGGGAGCCTTCCCCTGG + Intronic
988800312 5:34690465-34690487 GGCCACTGTGAGCAACACCCAGG + Intronic
996837291 5:127807501-127807523 AGGCACAGTGAACTAGACCCAGG - Intergenic
997778360 5:136631308-136631330 GGGCACAGGAAGCCACAGCAGGG + Intergenic
998898030 5:146821042-146821064 TGGTACATTCAGCCACACCCTGG + Intronic
1000177507 5:158772058-158772080 GAGCACAGTGAGCCAAACTCGGG + Intronic
1003110406 6:3248207-3248229 GGGCACAGTGAGACTCCCCGAGG - Intronic
1003175228 6:3749202-3749224 GGGGACAGTCTGGCACACCCTGG - Intronic
1003443701 6:6166014-6166036 TGACACAGTGAGCCACCCCAAGG - Intronic
1003592293 6:7446217-7446239 GGGCTCCCGGAGCCACACCCAGG - Intergenic
1006785266 6:36662440-36662462 GTGCTCAGTGAGGCACACCTGGG - Intergenic
1007091823 6:39189586-39189608 GGACACAGTGGGCCAGCCCCAGG + Exonic
1009756945 6:67952324-67952346 AGACACAGTGAGTCAGACCCAGG + Intergenic
1015734961 6:136389338-136389360 GGACAAAGTGAGCCGCCCCCCGG - Exonic
1018370378 6:163162748-163162770 GGACCCAGTGGGCCTCACCCTGG - Intronic
1018441748 6:163820183-163820205 GTGCTCAGTGAGTCACACTCAGG - Intergenic
1018876791 6:167827628-167827650 GGGCGCCGCGAGCCACAACCGGG - Intronic
1018961105 6:168449108-168449130 GGACACAGGGAGCCACAGGCAGG - Intronic
1019126512 6:169844220-169844242 ACCCAGAGTGAGCCACACCCCGG - Intergenic
1021579629 7:22139237-22139259 GACCACAGTGAGCCACACGCAGG + Intronic
1023678158 7:42652530-42652552 GGCCACAGTTTGCCACCCCCTGG - Intergenic
1024547770 7:50536832-50536854 GAGGACAGTGAGGCACACACTGG - Intronic
1024981145 7:55158739-55158761 GGCCTCAGTGAGTCACACCCTGG - Intronic
1025007441 7:55365633-55365655 GGGCGCAGCGATCCCCACCCCGG + Exonic
1027161666 7:75807184-75807206 AGGCACAGGGAGCCACATACTGG - Intergenic
1027223048 7:76226218-76226240 GGACACAGTGGGCCACAAACTGG - Intronic
1029254449 7:99260103-99260125 AGGCACAGAGAGCCTCTCCCAGG - Intergenic
1031907582 7:127477969-127477991 GAGAACAGTGAGCCACACAGAGG - Intergenic
1032194597 7:129781646-129781668 GGGCACGGTGAGCGAGAACCCGG + Intergenic
1033137906 7:138799945-138799967 GGACACACTGACCCACAGCCAGG + Intronic
1033589002 7:142795434-142795456 GGGCACAGTGAGCCCCACCAGGG + Intergenic
1033843826 7:145407643-145407665 AGGCACAGACTGCCACACCCAGG + Intergenic
1034547099 7:151796308-151796330 GGGCCCAGTGAGACACCCACAGG + Intronic
1035161537 7:156953847-156953869 GGCCACACTGAGGCATACCCTGG - Intronic
1036544059 8:9749421-9749443 AGCCACAGTGAACCACTCCCTGG - Intronic
1036707194 8:11054791-11054813 GGCCCCAGTGAGCACCACCCTGG - Intronic
1037744151 8:21629949-21629971 GGCCACAGTCAGCCACCCCCAGG + Intergenic
1038023080 8:23566394-23566416 GGTCACAGGGAGGAACACCCTGG - Intronic
1038269563 8:26064286-26064308 AGCCACTGTGAGCCACACCTAGG + Intergenic
1038474823 8:27858174-27858196 GGGAAGAGTGAGGCACTCCCTGG + Intergenic
1039803597 8:40980778-40980800 GGCCACAGTGAGTCACCCTCGGG - Intergenic
1040386177 8:46916407-46916429 GGGCTCAGGGACCCACACCCTGG - Intergenic
1041004810 8:53487520-53487542 AGGCACAGAAAGCCACCCCCAGG - Intergenic
1042877597 8:73453850-73453872 GGCTACACTGACCCACACCCGGG - Intronic
1043033500 8:75168719-75168741 GGACACACTGTGCCACATCCAGG + Intergenic
1046004394 8:108461869-108461891 GGTTGCAGTGAGCCACAGCCTGG - Intronic
1049255558 8:141611909-141611931 TGGCACTGTGAGCCACATCTGGG + Intergenic
1049494113 8:142921728-142921750 GGGTGCTGGGAGCCACACCCAGG + Intergenic
1053069714 9:35093965-35093987 GGCCACAGTGGTCCACACCCAGG + Exonic
1053294412 9:36902636-36902658 GGGCATGGGAAGCCACACCCTGG + Intronic
1056491393 9:87111052-87111074 GGCCACATTTTGCCACACCCTGG + Intergenic
1057189757 9:93080173-93080195 AGGCACACTCCGCCACACCCAGG - Intronic
1058161701 9:101577050-101577072 GGGAACAGTCATCCACAGCCTGG + Intronic
1058381783 9:104384609-104384631 GGGCACATTGAGACACACATTGG + Intergenic
1058892019 9:109369518-109369540 GGGCAGAGTGACTCACACTCTGG + Intergenic
1059176857 9:112175590-112175612 GGGCTCAGGGAGGCACCCCCGGG + Intergenic
1059339186 9:113587850-113587872 CAGCACAGGGCGCCACACCCAGG - Intronic
1059919243 9:119139175-119139197 GGGCAGTGTGAGCCTCAGCCGGG - Intergenic
1060195527 9:121621050-121621072 TGGGACAGGGAACCACACCCAGG + Intronic
1061707686 9:132465577-132465599 AGGCACAGAAAGACACACCCTGG + Intronic
1062005536 9:134236846-134236868 AGGCACAGTGACTCACACACAGG + Intergenic
1062050691 9:134445046-134445068 GGGGACACAGAGCCAAACCCTGG - Intergenic
1186767275 X:12783533-12783555 GAGCACAGGAATCCACACCCAGG - Intergenic
1187388767 X:18872227-18872249 TGACACTTTGAGCCACACCCGGG - Intergenic
1188746145 X:33847034-33847056 AGGCACACTGAGGCACACTCAGG - Intergenic
1191875207 X:65788499-65788521 GGGCAGAGGGAGCCCCAGCCGGG - Intergenic
1192232821 X:69277814-69277836 GGGCTCAGTGGGCCCCAGCCAGG + Intergenic
1193467787 X:81868849-81868871 GGGCAGTTGGAGCCACACCCAGG + Intergenic
1193572431 X:83160873-83160895 TGGCTCAATGACCCACACCCAGG - Intergenic
1199437466 X:147828739-147828761 GGGAACAGTGGTCCACACACAGG + Intergenic