ID: 1142668282

View in Genome Browser
Species Human (GRCh38)
Location 17:1474893-1474915
Sequence GCCTCCCCGCAGGCCCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 255}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668275_1142668282 20 Left 1142668275 17:1474850-1474872 CCAGAAACCCTGGGAGGGGAGAA 0: 1
1: 0
2: 4
3: 32
4: 320
Right 1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 29
4: 255
1142668276_1142668282 13 Left 1142668276 17:1474857-1474879 CCCTGGGAGGGGAGAACCGACGT 0: 1
1: 0
2: 1
3: 2
4: 73
Right 1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 29
4: 255
1142668277_1142668282 12 Left 1142668277 17:1474858-1474880 CCTGGGAGGGGAGAACCGACGTG 0: 1
1: 0
2: 1
3: 3
4: 107
Right 1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 29
4: 255
1142668279_1142668282 -3 Left 1142668279 17:1474873-1474895 CCGACGTGAGGTGAGACAGAGCC 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG 0: 1
1: 0
2: 0
3: 29
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668282 Original CRISPR GCCTCCCCGCAGGCCCCTGT GGG Intronic
900488220 1:2933539-2933561 TGCTCCCCGCAGACCCCTGTAGG + Intergenic
900488230 1:2933570-2933592 TGCTCCCCGCAGACCCCTGCAGG + Intergenic
900489241 1:2938680-2938702 GCCTCTCCGCAGCCCCTTGGAGG - Intergenic
900896106 1:5484067-5484089 CCCTCCCAGCAGTCCTCTGTTGG + Intergenic
901426309 1:9183829-9183851 GCCTCCTCTCAGGCCCCCGAGGG - Intergenic
901490480 1:9594071-9594093 GCCTCCCTGCATTCTCCTGTAGG + Intronic
902813839 1:18904803-18904825 CCCTCCCCCCAGGGCCCTGGGGG + Exonic
903022846 1:20406032-20406054 CCCTCCCTGCAGACACCTGTGGG - Intergenic
903548626 1:24142571-24142593 GCCTCCCTCCATGCCCCTGCAGG - Intronic
903687480 1:25142515-25142537 GCCTCCCATTAGTCCCCTGTAGG - Intergenic
904757131 1:32774123-32774145 GCTTCCCCATTGGCCCCTGTGGG + Exonic
905440834 1:37995980-37996002 GCCTCGCTGCAGGCAGCTGTGGG + Intergenic
905627377 1:39497925-39497947 TCCTCCAGGCAGGGCCCTGTGGG - Intronic
905669052 1:39779186-39779208 TCCTCCAGGCAGGGCCCTGTGGG + Intronic
906294117 1:44638578-44638600 GCTTCCCACCAGGCCCCTGGAGG + Intronic
907493939 1:54829367-54829389 GCCAACCAGCAGGTCCCTGTGGG + Intronic
907527881 1:55064235-55064257 GGCTCCCCGCAGGCCACCTTTGG - Exonic
909183123 1:72450009-72450031 GCCTGTCCTCAGGCCCCTGATGG - Intergenic
910156467 1:84225102-84225124 GCCTGTCCTCAGGCCCCTATTGG + Intronic
913962672 1:143352384-143352406 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
913963988 1:143359728-143359750 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
913998869 1:143675389-143675411 TCCTCCTCGCAGTTCCCTGTTGG - Intergenic
914057027 1:144177969-144177991 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
914058352 1:144185332-144185354 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
914120796 1:144781039-144781061 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
914122119 1:144788397-144788419 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
914224281 1:145707549-145707571 GCCTCCCCGCAGGGCCAGGCAGG - Intronic
918177251 1:182057243-182057265 CCCGCCCCGCAGGCACCTGTAGG + Exonic
919903177 1:202058795-202058817 GCCTCACCTCTGGCCCCTGAGGG - Intergenic
922714364 1:227859221-227859243 GCCTCCCCGCCCACCCCTGCGGG + Intergenic
922909543 1:229204212-229204234 TCCTGCACACAGGCCCCTGTCGG - Intergenic
923627691 1:235627692-235627714 GCCTCTCCCCAGGACACTGTTGG + Intronic
924223556 1:241902604-241902626 GCCTCCCTTCAGGCTCCTGCAGG + Intergenic
924917650 1:248590263-248590285 GCCTCCGCCCAGGCCCCGGAAGG + Intergenic
1062796831 10:351138-351160 GGCTACCCGCAAGCCCCTCTGGG - Intronic
1063376696 10:5558398-5558420 GCCTCCGCCCAGGCTCCTCTGGG - Intergenic
1069816068 10:71195257-71195279 CCCTCCCCGCAGCCCTCTCTGGG + Intergenic
1069900033 10:71701870-71701892 GCATCCCCGCTGGGCCCGGTAGG - Intronic
1073363514 10:102918600-102918622 GCCGCCCCGCAGCCGCCTGCAGG - Exonic
1074162202 10:110844467-110844489 AGCTCCCCACAGGCCCATGTGGG - Intergenic
1075662872 10:124210248-124210270 CCCTCCCCACAGGTCTCTGTGGG - Intergenic
1076305495 10:129463180-129463202 GACTCGTTGCAGGCCCCTGTGGG - Intergenic
1076402694 10:130194208-130194230 GCTGCCCTGCAGGCCCCTGGAGG + Intergenic
1076745482 10:132510606-132510628 GCCTCCCCACAGGGCCCTGCCGG + Intergenic
1077328751 11:1974805-1974827 GCCTCCCCACAGGCCCCCGCTGG - Intronic
1077501091 11:2910011-2910033 GCCTCCCAGCAGCCTCCTGCTGG + Intronic
1077670716 11:4154766-4154788 ACATCCCCTCAGGCCCTTGTGGG + Intergenic
1078934858 11:15941503-15941525 GCCTCCCCGGAGGGCCCTCACGG + Intergenic
1079126491 11:17721452-17721474 GCCGCCCCGCAGTGCCCTGCGGG + Exonic
1081848766 11:46260408-46260430 GCCTCCCCACCTGCCCCTGTGGG - Intergenic
1082076926 11:47981440-47981462 GCCGCCCCTCGGGCCCCTGCAGG - Intronic
1083277597 11:61606003-61606025 TCCTTCCCCCAGGCCTCTGTAGG - Intergenic
1084174601 11:67416729-67416751 GCCTCCCAGCAGCCCCATATTGG + Intronic
1084413935 11:69019625-69019647 GCTTCCCGCCAGGCCCCTGAGGG - Intergenic
1085689296 11:78652417-78652439 CCTTCCACCCAGGCCCCTGTGGG - Intergenic
1086455615 11:86956072-86956094 GCCTCCCCGCTGGCGGCTGGAGG - Intergenic
1087293290 11:96341861-96341883 GCGCCCCCGCAGGCCCCCGCAGG - Exonic
1090471652 11:126986147-126986169 GGCTCCCCCCAAGCCCCTCTTGG + Intronic
1202811730 11_KI270721v1_random:29984-30006 GCCTCCCCACAGGCCCCCGCTGG - Intergenic
1091682487 12:2537056-2537078 GCCTCCCTGCCGGCTCCTCTGGG - Intronic
1094829969 12:34295666-34295688 GCCTTCCCGGCAGCCCCTGTGGG + Intergenic
1094837195 12:34327676-34327698 GCCTCCCAGCAGGCCCTGGGCGG - Intergenic
1096532751 12:52252273-52252295 GCCCTCCAGCAGGCGCCTGTAGG + Intronic
1096537906 12:52287113-52287135 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096540865 12:52306247-52306269 GCCCTCCAGCAGGCGCCTGTAGG - Exonic
1096542507 12:52315904-52315926 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096549373 12:52362262-52362284 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096552184 12:52380374-52380396 GCCCTCCAGCAGGCGCCTGTAGG + Exonic
1096604631 12:52755672-52755694 GCCTCTACCCAGGCCCCTGAGGG - Intergenic
1096679062 12:53242701-53242723 GCCTCCCCCACGGCCCCTGAAGG + Intergenic
1096792440 12:54053514-54053536 GTCTCCCCTCAGGCCTCTGCTGG - Intronic
1096809278 12:54159350-54159372 GCCTCCCCACACTCTCCTGTTGG - Intergenic
1097098029 12:56565575-56565597 GCCTCTCCACAGTCCCCTTTTGG - Intronic
1098282060 12:68871714-68871736 GGCTCCCGACAGGCACCTGTTGG - Intronic
1103089645 12:118088636-118088658 CCCTCCCCGCTGGCCACTGTCGG + Intronic
1103377618 12:120469293-120469315 GCCTCCGCGCAGACCCCTCACGG - Intronic
1103931582 12:124453548-124453570 GCCTCCTCCCTGGCCCCTGCTGG - Intronic
1104706260 12:130949730-130949752 GCCTCCCCTCCGGCTCCTGTCGG - Intergenic
1104866877 12:131961115-131961137 GCATCCACGAAGCCCCCTGTAGG - Exonic
1104885426 12:132104483-132104505 GCATCCACGAAGTCCCCTGTAGG - Exonic
1105345172 13:19564928-19564950 GCCTCGCCGCAGACACCTGCAGG + Intergenic
1106134120 13:26961582-26961604 GCCTCTCTGCAGGCCCCAGTGGG - Intergenic
1107146890 13:37069773-37069795 GCCGCCCCGCAGCCCCTTGGGGG + Intergenic
1108559457 13:51628199-51628221 GCCGCCCCTCAGGCCCCACTGGG + Intronic
1111576072 13:90155203-90155225 GCCACCCCCCAAACCCCTGTTGG - Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114454891 14:22847944-22847966 GCCACCCCGCTGCCCCCTATGGG - Intronic
1114614062 14:24059123-24059145 GCCTCCCTGCAGGACCCTGGAGG + Exonic
1119027792 14:71167722-71167744 GCCTCCCCGCAGGCCGGGCTCGG + Intergenic
1119933670 14:78570985-78571007 GCAGCCCCGCTGGGCCCTGTGGG + Intronic
1121585735 14:95061787-95061809 CCCTCCTCGCAGGCCTCTGTGGG - Intergenic
1122978617 14:105181274-105181296 GCCCGCCCGAAGGCTCCTGTCGG - Exonic
1123450516 15:20356927-20356949 GACCCCCCGCAGGCCCTGGTGGG - Intergenic
1123630716 15:22258146-22258168 GCCCGCCCGCCGGCCCCTGACGG + Intergenic
1124338392 15:28874077-28874099 GTCTCCCCGCAGGCCTCAGAAGG - Intergenic
1126009493 15:44288980-44289002 GCCTCGCCGCAGACACCTGCAGG - Exonic
1126811466 15:52410081-52410103 GCTTTCCCGCAAGCACCTGTAGG + Intronic
1127331428 15:57943791-57943813 GCCTCTCTGCTGGCCCCTCTGGG - Intergenic
1128642405 15:69349326-69349348 GAGTCCCAGCAGGCCCCTGAAGG + Intronic
1129468897 15:75739243-75739265 GCTGCCCCGCCGGGCCCTGTTGG + Intergenic
1130651259 15:85763351-85763373 GCCTGCCTGCAGGCGCCTCTGGG - Intronic
1130990645 15:88873835-88873857 GGCTCTCCGCAGGCCACTGAGGG - Exonic
1132574247 16:657323-657345 GCCCCCCCACAGGACCCAGTCGG - Intronic
1132683834 16:1154118-1154140 GCGCCCCCGCGCGCCCCTGTTGG + Intronic
1133349645 16:5093091-5093113 GTTGCCCCACAGGCCCCTGTTGG - Intronic
1136011156 16:27364071-27364093 GCCCCACGGCAGGCCCCTGCAGG + Exonic
1136343862 16:29663099-29663121 GGCACCCCGCTGGCCCCTGAAGG + Intronic
1136787855 16:32946284-32946306 TCCTGTTCGCAGGCCCCTGTGGG + Intergenic
1137626889 16:49914733-49914755 GCCTCACCCATGGCCCCTGTTGG - Intergenic
1138523956 16:57591066-57591088 GCCTCCCCGCCAGACCCTGTGGG - Intronic
1141322051 16:83020383-83020405 GCCTCCCCACTGCCCTCTGTGGG + Intronic
1141443272 16:84042841-84042863 GCCTCTCCCCAGCCCCCTGCAGG + Intergenic
1141592436 16:85077660-85077682 GCCTCTCCCCAGTCCCCTGCAGG - Intronic
1141972335 16:87492433-87492455 GCCCGCCCGCCGGCCCCTGACGG - Intergenic
1142480529 17:215787-215809 GCCTCCACGCTGCCACCTGTGGG + Exonic
1142595384 17:1027256-1027278 GCCTCCCTGCAGGCCACAGACGG - Intronic
1142604962 17:1076533-1076555 GGCTCCCCGCAGCCCTCTCTTGG + Intronic
1142668282 17:1474893-1474915 GCCTCCCCGCAGGCCCCTGTGGG + Intronic
1142882906 17:2895243-2895265 GCCTCCCCGCGGGCCCCCGAGGG - Intronic
1143570559 17:7755371-7755393 TCCTCCCCTCGAGCCCCTGTGGG - Intronic
1143780235 17:9225448-9225470 GGCCCCCCGCCAGCCCCTGTGGG - Intronic
1144778945 17:17798382-17798404 GCCTCCCCGCCGGGCTCTGCCGG - Exonic
1146266831 17:31458387-31458409 GCCTCCCCGCAATGCCCTGCGGG - Intronic
1146529619 17:33597249-33597271 CCTTCCCTGCAGGGCCCTGTGGG - Intronic
1146545141 17:33731803-33731825 GCCTTCCCAAAGGCCCATGTGGG - Intronic
1148859240 17:50595482-50595504 CCCTTGCCCCAGGCCCCTGTTGG + Intronic
1149849997 17:60028529-60028551 GCCTCCACCCAGCCCTCTGTGGG - Intergenic
1149860170 17:60117995-60118017 GCCTCCACCCAGCCCTCTGTGGG + Intergenic
1152234320 17:79130583-79130605 GCCTGCCCTCACGCCACTGTGGG - Intronic
1152337925 17:79708407-79708429 GGCCCCCCGCAGGCCCTGGTGGG + Intergenic
1152882883 17:82830461-82830483 GCCTCCTCGCCGGGGCCTGTGGG + Exonic
1160163505 18:76492095-76492117 ACCTCCCCGGAGACCCCTGCAGG - Intronic
1160175729 18:76592554-76592576 GCCACCCCCCAGCCCCCTCTGGG + Intergenic
1160426081 18:78780145-78780167 ACCTCCCTGCAGGCGCCTCTTGG - Intergenic
1160680090 19:408476-408498 GCCTCCCGGCAGGGCCCTGCCGG + Intronic
1160722326 19:603095-603117 GCCTTCCCCCAGGCACCTATGGG - Intronic
1160722413 19:603331-603353 GCCTTCCCCCAGGCACCTATGGG - Intronic
1160837153 19:1130096-1130118 GCGTCTCCTCAGGCCCCTCTGGG - Intronic
1161067961 19:2247816-2247838 GCCTCCCTGCTGGCCCCCCTGGG + Exonic
1161104585 19:2437029-2437051 GCCTCCCCTCTGGCTCCTGTGGG + Intronic
1161319956 19:3636562-3636584 TCCTCCCAGCAGGCCCCTCTGGG + Intronic
1163785145 19:19271115-19271137 CCCTCTCCACAGCCCCCTGTGGG - Exonic
1164156972 19:22602915-22602937 CCCTCCCCGCAGCCCCCCGCCGG - Intergenic
1164952177 19:32345843-32345865 TCCTCCCCTCAGGCCTCTGCCGG + Intronic
1166121037 19:40686948-40686970 ACCTGCCCCCAGCCCCCTGTGGG - Exonic
1166749986 19:45160007-45160029 GCTTCCTCACAGGCCTCTGTCGG + Intronic
1166869616 19:45863480-45863502 GCCTCTCCGCAGACCCCACTAGG - Intergenic
1166885229 19:45956373-45956395 ACCTCCCCAAAAGCCCCTGTGGG - Intronic
1167271049 19:48506505-48506527 GCCTCCCGCCAGGCCCCAGTAGG - Intronic
1167663246 19:50808694-50808716 GCCTTCCTGCAGGTACCTGTGGG + Intergenic
1167696059 19:51016146-51016168 TCCTTCCCCCAGGCCACTGTGGG - Exonic
1168231148 19:55032422-55032444 GCCTCCCCGCAGACCCCGCCTGG + Intronic
1168464214 19:56589175-56589197 GCCTCCCTCCTTGCCCCTGTGGG - Intergenic
1202696510 1_KI270712v1_random:130642-130664 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
1202697833 1_KI270712v1_random:137989-138011 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
927853361 2:26513496-26513518 ACCTCCCCGCAGCCCCCAGCAGG + Intronic
927964660 2:27261801-27261823 GCGTCTCTGCAGGCCCCTGCAGG + Intronic
932026445 2:68138479-68138501 GCCTGTCTGCAGACCCCTGTGGG - Intronic
934277672 2:91587667-91587689 GGCTCCTCCCAGGCCCCTGGTGG + Intergenic
934279004 2:91594985-91595007 GGCTCCTCCCAGGCCCCTGGTGG - Intergenic
937263629 2:120602022-120602044 GCCTCCCTGCAGGCTCCTGAGGG + Intergenic
937999327 2:127719813-127719835 GAGTACCCGGAGGCCCCTGTGGG + Exonic
945174096 2:207023945-207023967 GCCACTCCTCAGGCCCCTGGAGG - Intergenic
948055779 2:235008351-235008373 GCCTCCCTGCAGGGCCCAGGAGG + Intronic
948637428 2:239348572-239348594 TCCTGCCAGCAGGCCCCCGTGGG + Intronic
948653083 2:239461213-239461235 GCCTTCCCACAGGCCCCTGCTGG + Intergenic
948911622 2:241007887-241007909 GCCTGCACGAAGGCCCGTGTAGG - Intronic
948921192 2:241066676-241066698 GCCGCCCCGCAGGGCCCTGCTGG - Intronic
948982127 2:241499727-241499749 GCTTCCTGGCAGGCCCGTGTTGG - Intronic
1172614675 20:36275325-36275347 GCCTCCCTGCTGGCCCCTGGTGG - Intergenic
1173335222 20:42107002-42107024 GCCTCCCAGCAGGACCCTTGGGG - Intronic
1173638973 20:44585797-44585819 GCCTGGCCCCTGGCCCCTGTGGG + Intronic
1173672998 20:44810691-44810713 GCCTCCCCGCGCGCACCTGCCGG - Intergenic
1175294314 20:57897830-57897852 GCCTCCCCACTGGCCCCAGGAGG + Intergenic
1176008327 20:62878824-62878846 GCCGCCCCGGAGGCCGGTGTGGG - Exonic
1176075822 20:63247831-63247853 GCGTCCCCGCAGGCTGCAGTGGG - Intronic
1176161556 20:63651355-63651377 GCCTGACTGCAGGCTCCTGTTGG + Intronic
1176216426 20:63950154-63950176 GCCTCACCGCAGGCCTGTGACGG + Intronic
1178724093 21:35035972-35035994 GCCTCCCCAGAGGCTGCTGTGGG + Intronic
1178918464 21:36722789-36722811 GCCACCCCTGAGGCCCCTGATGG - Intronic
1179631094 21:42679216-42679238 GCCTGCCCGCAGGCTGCTGCTGG + Intronic
1179902889 21:44402967-44402989 GCCTCCCCCAGGGCCCCAGTAGG - Intronic
1180786386 22:18549996-18550018 GCCCCGCCCCAGGCTCCTGTCGG - Intergenic
1180800691 22:18630561-18630583 GCTTACCCTCAGGCCCCTGCTGG + Intergenic
1180851923 22:19026118-19026140 GCTTACCCTCAGGCCCCTGCTGG + Intergenic
1181221028 22:21364701-21364723 GCTTACCCTCAGGCCCCTGCTGG - Intergenic
1181652969 22:24271066-24271088 GCGTCCCCGCAGACCCCGGCAGG + Intronic
1182268848 22:29140163-29140185 GGCTCCCTGCAGGCCGGTGTGGG - Intronic
1182619803 22:31612898-31612920 GCCTCCACGCATCCCCCTGCAGG + Intronic
1183342182 22:37287550-37287572 GCCTCCCCGCCAGCTCCTGCCGG + Intronic
1183945496 22:41323577-41323599 GCCTCCCCGAAGCCGTCTGTTGG + Intronic
1185049162 22:48544729-48544751 GCCTCCCCGCAGCCCGGAGTGGG - Exonic
950418578 3:12883121-12883143 GCCTCCCCGCCCCCCGCTGTGGG + Intergenic
953918101 3:46933433-46933455 GCCTACCCAAAGGCCCCTGAGGG + Intronic
954291129 3:49650696-49650718 ACCTCACAGCAGCCCCCTGTAGG + Exonic
954813426 3:53262019-53262041 GACTCCTCCCAGGCCCCTGAAGG - Intergenic
956585514 3:70860533-70860555 CCCACCCTGCAGGCCCCTCTTGG + Intergenic
956719072 3:72102371-72102393 GTCTCCCCGTAGTCCCCAGTGGG - Intergenic
958026911 3:88059383-88059405 GAGTCCCCGCTGGGCCCTGTGGG + Exonic
960925923 3:122795024-122795046 GCCTCCCCGCCGGCCCGGCTCGG + Exonic
961445125 3:126976881-126976903 GCCTGCGCTCAGGACCCTGTGGG - Intergenic
961445326 3:126977946-126977968 TCATCCCCACATGCCCCTGTGGG - Intergenic
961746696 3:129068395-129068417 CACTCCCCGCCGGCCCCAGTGGG - Intergenic
961887627 3:130106816-130106838 GTTGCCCCACAGGCCCCTGTTGG - Intronic
962351494 3:134659795-134659817 TCCTCCCGCCAGGCCCCTGGGGG - Intronic
963131363 3:141861223-141861245 GCCTCTCCCCAGGCTCCTTTTGG - Intergenic
963851014 3:150210648-150210670 GCTTCCCTGCAGGGGCCTGTAGG + Intergenic
966444399 3:179985801-179985823 GCCTCCCCTCAGTCCCATTTTGG + Intronic
968471935 4:786428-786450 TCCTCCGCGGAGGCCCCTGAGGG - Exonic
968918936 4:3512465-3512487 GCTTCCCCTCTGGGCCCTGTGGG - Exonic
968996757 4:3950746-3950768 GTTGCCCCACAGGCCCCTGTTGG - Intergenic
971078033 4:23173017-23173039 ACTTCCCACCAGGCCCCTGTGGG + Intergenic
976218784 4:82739485-82739507 GCCTCCCCGCACTGCCCTGGAGG + Intronic
976326673 4:83779544-83779566 GCCTCCCTGGCGGCCCCTGGAGG - Intergenic
978159351 4:105527191-105527213 GCCTCCAGGCAGGCCCCTCCTGG - Intergenic
978761634 4:112359652-112359674 TCCTCCCCCAAGGCCCCTGCTGG - Intronic
985539801 5:482653-482675 GGCCCCGCGCAGGCCCCCGTAGG + Exonic
985573911 5:664971-664993 GCCGCCCCCCAGCCCCCTCTGGG + Exonic
985680191 5:1252080-1252102 GCCTTCCAGCAGGTCCCTGGTGG - Intergenic
985776870 5:1848912-1848934 GCCACAGCGCAGGCCCCTGAGGG + Intergenic
985824733 5:2183820-2183842 GCCTCCCCGCAGGCCCATCCAGG - Intergenic
991330204 5:65485560-65485582 GCCTCCCCCCCGGCCTCCGTGGG - Intergenic
994073718 5:95628743-95628765 GCCTCCACGCAGTCCCCAGTGGG - Intergenic
994077440 5:95669322-95669344 GCCTCATGGCAGGCCCATGTGGG + Intronic
996610096 5:125368381-125368403 GCCTCCACTCAAGCCTCTGTTGG + Intergenic
998004462 5:138647959-138647981 GACTCCCTGCAGGCCCCAGAGGG + Intronic
998162982 5:139823827-139823849 CCCAGCCTGCAGGCCCCTGTAGG + Intronic
1001308778 5:170595502-170595524 GGCTCCCTGCAGGACCCTCTGGG + Intronic
1001684640 5:173584312-173584334 ACCTCCCCACATGCCCCTTTTGG - Intergenic
1001780224 5:174361834-174361856 GCCTCCTGGCCTGCCCCTGTTGG - Intergenic
1002593200 5:180305104-180305126 GCCTCTCCCCAGGCCCTTGCTGG - Intronic
1002663099 5:180804062-180804084 GCCTCCACGCAGGGGCCTGCGGG - Intronic
1003016201 6:2469362-2469384 GCCTCCCCGCAGCACCCACTGGG - Intergenic
1004273016 6:14211741-14211763 GCCTCCCCGCACGCGCCTCTTGG + Intergenic
1004866435 6:19857460-19857482 GCCTCCTTCCAGGCCCCTGTGGG - Intergenic
1004908544 6:20259802-20259824 GCCTCCCCGCCGCCCTCCGTGGG + Intergenic
1007113650 6:39328217-39328239 GCCTCCACGTAGGACGCTGTGGG - Intergenic
1007741412 6:44012074-44012096 GCCTCCCCACTGGGCCCAGTTGG + Intergenic
1015440422 6:133241224-133241246 GCCTCCCCCGAGGCCCCCGGCGG + Intronic
1016569059 6:145492373-145492395 GCCACCCCCAAGGCCCCTGAGGG + Intergenic
1017401566 6:154070213-154070235 GCCTCCCACCAGGCTCGTGTGGG + Intronic
1017815323 6:158012086-158012108 ACCTCCCAGGAGGGCCCTGTAGG + Intronic
1019306912 7:339943-339965 GCTTCCTCCGAGGCCCCTGTGGG - Intergenic
1019325572 7:436672-436694 GGCTCCCCGCAGACCACTGAGGG - Intergenic
1019350008 7:550155-550177 GCCTCCCCGGCTGCCTCTGTGGG - Exonic
1019509621 7:1411251-1411273 CCCTCCCCACAGCCCCCTGGGGG + Intergenic
1022524482 7:31028457-31028479 GCCCCCACCCAGGCCCCTCTGGG - Intergenic
1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG + Intronic
1025145289 7:56496278-56496300 GCCTCCAGGTAGGGCCCTGTTGG + Intergenic
1027029045 7:74875022-74875044 GGCTCCCGGCAGGCCCGGGTGGG - Intergenic
1029479004 7:100801865-100801887 GCCTCCCCCCGGGCACCTGCAGG - Intergenic
1029545333 7:101207496-101207518 GTCTCCACGCAGACCCCTTTCGG - Intronic
1035017942 7:155782624-155782646 GCCACCCGGCAGGACCCTGGGGG + Intergenic
1035691269 8:1561649-1561671 ACAGTCCCGCAGGCCCCTGTGGG - Intronic
1037103792 8:15080307-15080329 GCCTCACCGAAGGACTCTGTGGG + Intronic
1039048565 8:33472706-33472728 GCCTCCCCGCCTGCCCCGATCGG - Intronic
1039454583 8:37698349-37698371 GGCTCCCGGCAGGGCCGTGTGGG - Exonic
1039848397 8:41342351-41342373 GCCTCCTTTCAGGCCACTGTGGG + Intergenic
1049743932 8:144255072-144255094 GCCACCCCACAGGCACCTGGAGG + Intronic
1051193074 9:14534759-14534781 GACGCCCCGCAGGCCCCCGACGG - Intergenic
1054805925 9:69395836-69395858 ACCTCCCCCCAGGCTGCTGTAGG + Intergenic
1056684980 9:88752038-88752060 GGCTCCCCGCAGGAGCCTCTGGG - Intergenic
1056752559 9:89363012-89363034 GCCTCACCTGAGGCACCTGTTGG - Intronic
1057337484 9:94166760-94166782 GCCTTCCGGCCGGCGCCTGTTGG + Intergenic
1059119207 9:111627036-111627058 GCCTCTCCCCAGGCTCCTGGTGG + Intergenic
1060673997 9:125495822-125495844 GACTTCCCACAGGCCCCTTTGGG - Intronic
1060827787 9:126696377-126696399 GGCTCCCTGCAGGCCCGCGTGGG + Exonic
1060986923 9:127825347-127825369 GTCTCCCCGCAGGCCCCGGACGG - Exonic
1061225398 9:129278344-129278366 TCCTCTCCGCAAGCCCCTGGGGG - Intergenic
1062042364 9:134409977-134409999 TCCTCCCCGCCAGCCCCTGGTGG + Intronic
1062081891 9:134628521-134628543 GCCTCCCCGGGGGCCTCTGGAGG - Intergenic
1062266388 9:135688277-135688299 GCCTCCCTGGATGCCCCTGCTGG - Intergenic
1185455028 X:305044-305066 CCCACCCCGCAGGCCTCTGTGGG + Exonic
1185877542 X:3713039-3713061 GCCACGCCGCGCGCCCCTGTGGG + Intronic
1185894103 X:3843292-3843314 GCCGCGCCGCGCGCCCCTGTGGG + Intronic
1185899221 X:3881716-3881738 GCCGCGCCGCGCGCCCCTGTGGG + Intergenic
1185904338 X:3920145-3920167 GCCGCGCCGCGCGCCCCTGTGGG + Intergenic
1187332450 X:18353979-18354001 GCCTCCCCGCCAGCCCCGGACGG + Intronic
1190789592 X:53686471-53686493 GCCTCCGCGCAGGGTCCCGTGGG + Intronic
1195210768 X:102651278-102651300 GCCAACCCGCAGGCCCCGGCTGG + Intergenic
1195524005 X:105865009-105865031 GCCCCCCTTCAGGCTCCTGTTGG + Intronic
1199680793 X:150223298-150223320 GCCTCACCGCAGGCCTTTGTGGG - Intergenic
1200128573 X:153829632-153829654 CCCTCCCCGCGGGGCCCTGCTGG + Intronic
1200787762 Y:7274505-7274527 GCCGCGCCGCGAGCCCCTGTGGG - Intergenic
1201416490 Y:13752922-13752944 GCCTCCGCGCAGGCCCCGCGGGG - Intergenic