ID: 1142668497

View in Genome Browser
Species Human (GRCh38)
Location 17:1475968-1475990
Sequence ATGCATAGAAAAAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 778
Summary {0: 1, 1: 0, 2: 8, 3: 77, 4: 692}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668491_1142668497 16 Left 1142668491 17:1475929-1475951 CCCTGAGCCTTATACACAAGTTC 0: 1
1: 0
2: 0
3: 6
4: 126
Right 1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG 0: 1
1: 0
2: 8
3: 77
4: 692
1142668493_1142668497 9 Left 1142668493 17:1475936-1475958 CCTTATACACAAGTTCTCGACTA 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG 0: 1
1: 0
2: 8
3: 77
4: 692
1142668492_1142668497 15 Left 1142668492 17:1475930-1475952 CCTGAGCCTTATACACAAGTTCT 0: 1
1: 0
2: 1
3: 3
4: 124
Right 1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG 0: 1
1: 0
2: 8
3: 77
4: 692

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668497 Original CRISPR ATGCATAGAAAAAGGCAGGA GGG Intronic
900034734 1:397639-397661 ATGCATGGAAAAAGAAAGGTAGG + Intergenic
901513464 1:9730048-9730070 ATGTATAAATAATGGCAGGATGG - Exonic
901943626 1:12683416-12683438 GTGGAGAGGAAAAGGCAGGAGGG + Intergenic
902836210 1:19048377-19048399 AAGGAAAGAAAAAGGAAGGAAGG + Intergenic
902946227 1:19841880-19841902 ATACATTGAAAATGTCAGGAGGG + Intergenic
902946553 1:19844743-19844765 ATGCGTAGAAAAAGGCCTGGAGG - Intergenic
903027026 1:20436719-20436741 TTCCATGGAAAAAGGGAGGAGGG - Intergenic
903747734 1:25599690-25599712 AAAGATAGAAAAAGGAAGGAAGG + Intergenic
904131173 1:28276550-28276572 AAGGAAAGAAAAAGACAGGAAGG - Intronic
904279968 1:29412242-29412264 ATGCACAGAAAAAGACAGGCAGG + Intergenic
904330338 1:29754417-29754439 ATGCACAGGAGAGGGCAGGAGGG - Intergenic
904679229 1:32217125-32217147 CTGCAGAGGAAAGGGCAGGATGG + Intronic
904749195 1:32730487-32730509 ATGCGTAGAAAAAGGCCAGAGGG + Intergenic
904749297 1:32731093-32731115 AAGAAAAGAAAAAGGCTGGAGGG + Intergenic
904771592 1:32884303-32884325 AGGGAAAGACAAAGGCAGGAGGG + Intergenic
904919627 1:33996820-33996842 AAGCAGAGAGAAAGGCAGGAAGG + Intronic
905019648 1:34799940-34799962 ATGCATGGAAGAAGGCTGGAGGG - Intronic
905638234 1:39570307-39570329 ATGCATAGAAAAGGTCTGGAAGG + Intronic
905943662 1:41884268-41884290 ATGCATAGAAAATTACTGGAGGG - Intronic
905949982 1:41942027-41942049 AATAATAGAAAAAGGGAGGAAGG + Intronic
906377511 1:45307576-45307598 ATGCAAAGAAAAATGTAGGCGGG - Intergenic
907068848 1:51516586-51516608 AAGCTTGGAAAAAGGAAGGAAGG + Intronic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
907570350 1:55477501-55477523 ATGCTTAGCCAAAGGAAGGATGG - Intergenic
907801144 1:57766972-57766994 ATGCATAGAACAAGGTATGGTGG + Intronic
907913985 1:58852321-58852343 ATGCACAGAAAAGGGAGGGAGGG + Intergenic
907940617 1:59083873-59083895 ATGAATAAAAAAAGGAAAGAAGG + Intergenic
909448595 1:75774157-75774179 TTGGGTAGAAAAAGGCAGGGAGG + Intronic
909554412 1:76937572-76937594 ATGCACACATAAAGGAAGGATGG + Intronic
909655033 1:78022039-78022061 ATGGATACAAAAAGCCTGGATGG + Intronic
909861718 1:80614297-80614319 CTACATAAAAAAAGGCAGAAAGG - Intergenic
909944241 1:81645541-81645563 ATGCATGGAAAAATTCTGGAAGG - Intronic
910176529 1:84436693-84436715 ATGAATAGAGGAAGGAAGGAAGG + Intergenic
910265089 1:85330144-85330166 ATGCAGAGAAAGATGCAGGAAGG + Intronic
910563087 1:88613414-88613436 ACTCTTAGAAGAAGGCAGGATGG + Intergenic
910999678 1:93149853-93149875 ATGCATAGGAAAAAACAGGCCGG + Exonic
911090618 1:94014295-94014317 AAGCAATGAAAAAGGAAGGAAGG + Intronic
911378374 1:97079890-97079912 ATGGAAAGAAAAAGAGAGGAAGG - Intronic
911462275 1:98205936-98205958 AAGGATAAAAAAGGGCAGGAAGG + Intergenic
911939986 1:104032886-104032908 ATGCAGAAAAAAAGTCAGAAGGG - Intergenic
912552290 1:110492116-110492138 GTGCAAAGAAAAAGGGAGGAGGG - Intergenic
912616892 1:111110808-111110830 ATGCATTGAAGAAGGTAGGAAGG - Intergenic
913366291 1:118042884-118042906 ATGCATAAACAAAGCAAGGAAGG - Intronic
913608458 1:120488107-120488129 ATGCATTGAAGAAGGGAGGAAGG - Intergenic
913647906 1:120878381-120878403 AAGAAAAGAAAAAGGAAGGAAGG + Intergenic
913986968 1:143574562-143574584 ATGCATTGAAGAAGGGAGGACGG + Intergenic
914298527 1:146355599-146355621 AAGAAAAGAAAAAGGAAGGAAGG - Intergenic
914370198 1:147017888-147017910 ATGCATTGAAGAAGGGAGGAAGG - Intergenic
914409555 1:147413093-147413115 AGGCATACAAAGAAGCAGGAAGG - Intergenic
914484495 1:148095525-148095547 ATGCATTGAAGAAGGGAGGAAGG + Intergenic
914582743 1:149033730-149033752 ATGCATTGAAGAAGGGAGGAAGG + Intronic
914638103 1:149572926-149572948 AAGAAAAGAAAAAGGAAGGAAGG + Intergenic
914975997 1:152362913-152362935 ATGAGTAGAACAAGGCAGGAAGG - Intergenic
915024126 1:152811426-152811448 ATGCCTAGATCAGGGCAGGAGGG + Intronic
915298376 1:154937658-154937680 ATGCTCAGAAAAATGCAGGACGG - Intergenic
915732692 1:158065484-158065506 CTGCCCAGGAAAAGGCAGGATGG + Intronic
916823610 1:168423941-168423963 ATGTACATAGAAAGGCAGGAAGG + Intergenic
917145922 1:171891518-171891540 CTGGATAGAAAAAGGCAAGCAGG - Intronic
917236461 1:172897840-172897862 CTGAATAGAGAAAGACAGGAAGG - Intergenic
919452585 1:197788544-197788566 ATGCATTGAAGAGGGTAGGAAGG - Intergenic
919472777 1:197999484-197999506 TTGTATGAAAAAAGGCAGGATGG + Intergenic
919670489 1:200333210-200333232 ATGCATAGGGCAAGGCAGGTGGG - Intergenic
921065621 1:211620497-211620519 ATGCAGAGAAATACCCAGGAGGG + Intergenic
921742176 1:218697859-218697881 ACACATAGAAAATGGCAGAAAGG + Intergenic
921746465 1:218745845-218745867 CTTCACAAAAAAAGGCAGGAAGG + Intergenic
922120031 1:222656591-222656613 ATGCAAAAGAAAAAGCAGGAGGG - Intronic
922257257 1:223903197-223903219 ATGCATGGAAAAAGAAAGGTAGG + Intergenic
923028464 1:230226222-230226244 AGGGAAAGAAAAGGGCAGGAAGG - Intronic
923159295 1:231303162-231303184 AAGCTTAAAACAAGGCAGGAAGG - Intergenic
923460453 1:234205609-234205631 AAGCCTAGAGAAAGGCATGAGGG + Intronic
923743245 1:236675226-236675248 ATGCATAGAAAAATTCTGAAAGG + Intergenic
924024158 1:239815439-239815461 AATCAGAGAAAAAGGCAGGAGGG - Intronic
924039171 1:239966611-239966633 ATGGAAACAAAAAGGAAGGAAGG - Intergenic
924338452 1:243005989-243006011 ATGCATGGAAAAAGAAAGGTAGG + Intergenic
924447710 1:244149338-244149360 ATATACAGAAAAAGGTAGGATGG + Intergenic
924787171 1:247209599-247209621 AGGCACAGAAAAAGACTGGAGGG + Intergenic
924913975 1:248547120-248547142 AAGCATTGAAGAGGGCAGGAAGG + Intergenic
924930587 1:248728767-248728789 ATGCATAAACAAAGCAAGGAAGG + Intronic
1063051457 10:2453801-2453823 ATGCAGAGAAAAAGGGAATATGG + Intergenic
1063506961 10:6608304-6608326 ATGAATAAAAGAAGGTAGGAAGG - Intergenic
1063650023 10:7925821-7925843 AAGAAAAGAAAAAGGAAGGAAGG + Intronic
1064890177 10:20162137-20162159 AAGGAAAGAAAAAGGAAGGAAGG + Intronic
1064938152 10:20703303-20703325 AGGCCAAAAAAAAGGCAGGAAGG - Intergenic
1064956685 10:20918947-20918969 ATGCATAGGAAAATTCTGGAAGG + Intronic
1065113701 10:22464176-22464198 ATGGAGAGAGAAAGGGAGGAAGG + Intergenic
1065156919 10:22879773-22879795 CTTCATAGAAAAAGTTAGGAAGG + Intergenic
1065382188 10:25101778-25101800 ATGCATAAAACAAGGCAAGTTGG - Intergenic
1066165750 10:32787461-32787483 ATGCATTGAATAGGGGAGGAAGG + Intronic
1066275963 10:33868947-33868969 ATGCATAAGAAAAGTCAGGCCGG - Intergenic
1066326934 10:34369808-34369830 ATGCCTAGAAATGGGGAGGAGGG - Intronic
1066588104 10:36960604-36960626 ATGCATAGAGTAAGGCATGTGGG + Intergenic
1067052884 10:43034205-43034227 ATGCACAAAGGAAGGCAGGAAGG - Intergenic
1068761488 10:60715555-60715577 AAGCACAGAGACAGGCAGGAGGG + Intronic
1070239501 10:74664346-74664368 ATGCATAGAAAAATTCTAGAAGG + Intronic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1071243481 10:83736912-83736934 ATGCATTGAAGATGGTAGGAAGG - Intergenic
1071466895 10:85949320-85949342 ATGCATAGAAAGGGTCTGGAAGG - Intronic
1071575553 10:86723319-86723341 ATGCATGGATAAATGGAGGAGGG + Intronic
1072415556 10:95243906-95243928 ATTCATAGAGACAAGCAGGAGGG + Intronic
1072553066 10:96493847-96493869 AGGCCTAGAAGAAGGCAGGAAGG + Intronic
1072599911 10:96915880-96915902 ATGCCTAGAGAAAGGCTGAAGGG - Intronic
1072902670 10:99422679-99422701 AGGCATAGGGAAATGCAGGAAGG - Intronic
1072950753 10:99844743-99844765 ATGCAGAGAGGAAGTCAGGAAGG + Intronic
1073167708 10:101472244-101472266 AAGAAAAGAAAAAGGAAGGAAGG - Intronic
1073909797 10:108328589-108328611 ATGGGTAGAAAAAGGCAAGGTGG + Intergenic
1074025821 10:109633128-109633150 ATGCAAACAAAAATGCAGGCTGG - Intergenic
1075142967 10:119856546-119856568 GTGACTAGAAAAAGGCAGAAAGG + Intronic
1075323695 10:121512768-121512790 ATGAATAAATAAAGGAAGGAGGG + Intronic
1075442863 10:122493612-122493634 ATGTATTGAAGAAGGTAGGAGGG + Intronic
1075583969 10:123643886-123643908 ATGCTTAGAAAAGGGCTGGAAGG - Intergenic
1077903984 11:6514524-6514546 AGGGAGAGAAAAAGGGAGGAAGG - Intronic
1078123387 11:8533825-8533847 ATACATAGCAAAAGGAAAGAAGG + Intronic
1078636976 11:13060735-13060757 ATGCATGGAGAAGGGCGGGAAGG + Intergenic
1078718423 11:13861143-13861165 AAGGATAGAAAAAGGAAAGAAGG - Intergenic
1079494864 11:21030843-21030865 ATGCATAGTAAAACCCTGGAAGG - Intronic
1079952981 11:26827332-26827354 AGGCATGGAAGGAGGCAGGAAGG + Intergenic
1080267154 11:30413460-30413482 ATGATTTGAAAAAGGCAGGTCGG + Intronic
1080580664 11:33640627-33640649 ATGCATAGAAAACATCTGGAAGG + Intronic
1080944650 11:36958044-36958066 ATGCATTGAAGAGGGTAGGAAGG + Intergenic
1081640533 11:44750327-44750349 AGCCATAGATAAAGGCTGGATGG + Intronic
1082255468 11:50028622-50028644 ATGCATTGAAGAGGGTAGGAAGG + Intergenic
1082735873 11:56854995-56855017 AAGGAAAGAAAAAGGAAGGAAGG + Intergenic
1083035830 11:59636427-59636449 ATGCCTAGAGATGGGCAGGATGG + Intergenic
1083319489 11:61836970-61836992 ATGTATAGAAAAAAGCTGGAAGG + Intronic
1083443118 11:62689941-62689963 ATGGACAGAGAAAGGGAGGAAGG + Intergenic
1083562077 11:63681200-63681222 ATTCACATAAAGAGGCAGGAGGG + Intergenic
1084422612 11:69067862-69067884 ATGAAAAGAAAAAGGGAGGAGGG - Intronic
1085224716 11:74909075-74909097 ATACAGAAAAAAAGGCAGGGGGG - Intronic
1085715926 11:78873161-78873183 GTGCACAGATAAAGGCAGGGGGG - Intronic
1085757216 11:79211877-79211899 ATGCTGTGAAGAAGGCAGGAAGG + Intronic
1085825638 11:79844192-79844214 ATGTATATCAGAAGGCAGGAGGG - Intergenic
1086847422 11:91768689-91768711 AGGGATGGAAAAAGGGAGGAAGG + Intergenic
1087362475 11:97178252-97178274 ATGCATAGAACAAGGCATGCTGG + Intergenic
1087810484 11:102604915-102604937 ATCCAGAGAAAACGTCAGGAGGG + Intronic
1088921681 11:114263917-114263939 AGGCAGAGAACCAGGCAGGAAGG - Intronic
1089315585 11:117588842-117588864 AGGAAGAGAAAAGGGCAGGAAGG - Intronic
1090167655 11:124568186-124568208 ATGCATAGGAAAAGTCTAGAAGG + Intergenic
1090291945 11:125553525-125553547 ATGGATGGAAAACAGCAGGAGGG - Intergenic
1090427730 11:126620694-126620716 AAGCATTGAAGAAGGCAGCAAGG - Intronic
1090981141 11:131723532-131723554 AAGGAAAGAAAAAGGAAGGAAGG - Intronic
1091157245 11:133385058-133385080 ATGGATAGAATAATGCAGAAGGG + Intronic
1091222616 11:133938065-133938087 ATGCAAGGACAAAGGAAGGAAGG + Intronic
1091958498 12:4669639-4669661 AAGAAGAGAAAAAGGAAGGAAGG - Intronic
1092173397 12:6387258-6387280 ATGCATAGAAAATGTCCGGGAGG - Intronic
1092926334 12:13275707-13275729 AGGCACAGTGAAAGGCAGGAAGG + Intergenic
1092990610 12:13894509-13894531 ATGCATAGAAAAATGCTGGAAGG + Intronic
1094491941 12:30966233-30966255 AGCCATAAGAAAAGGCAGGAGGG + Intronic
1094731904 12:33186406-33186428 ATTAATAGAAAAAGGAAGAAGGG + Intergenic
1095616980 12:44202288-44202310 ATGCACATAAAAAGGTATGATGG + Intronic
1095798138 12:46243250-46243272 GTGCATAGAAAAACCCTGGAAGG - Exonic
1095868939 12:47004125-47004147 GTGCATAGAAAAATACTGGAAGG + Intergenic
1096253163 12:50046317-50046339 ATGCATAAATAAGGGGAGGAAGG + Intergenic
1096356241 12:50943255-50943277 ATGTATAGAACCAGGCATGAGGG - Intergenic
1096884688 12:54705166-54705188 ATACAAAGAAAAAGTCATGAAGG - Intergenic
1097320591 12:58221758-58221780 AAGCAGAGAAAATGGCAGAAAGG - Intergenic
1097803480 12:63940314-63940336 AGAAAAAGAAAAAGGCAGGATGG - Intronic
1097918881 12:65050023-65050045 CTGCTGAGAAAAAGGAAGGAGGG + Intergenic
1097929935 12:65171634-65171656 ATGAATATAAAAAAGCAGCAAGG + Intronic
1099235773 12:80080824-80080846 ATCAATAGAAAAAGGCGGGGGGG - Intergenic
1099247535 12:80212099-80212121 ATGCTAAGAACAAGACAGGAAGG + Intronic
1099251118 12:80256268-80256290 AGCCATAGAAAGAGACAGGAAGG - Intronic
1099423662 12:82495901-82495923 AAGCACAGAAAAATTCAGGAAGG + Intergenic
1100745148 12:97637418-97637440 ATGAAAAGAAGAAGGAAGGAAGG - Intergenic
1100856287 12:98760073-98760095 ATGCATAGAAAATAGCAATATGG + Intronic
1101122686 12:101599445-101599467 ATGCTTAGAAATAGGCAAGAGGG - Intronic
1101551407 12:105765774-105765796 ATGGACAGAAAAAGGAAGTAAGG + Intergenic
1101697687 12:107141679-107141701 ATGGAAAGATATAGGCAGGAAGG - Intergenic
1102099745 12:110269340-110269362 GTGCAGATAAAAAGGAAGGAAGG - Intergenic
1102508082 12:113396630-113396652 AAACAAAGAAAAAGGAAGGAAGG - Intronic
1103332030 12:120160899-120160921 ATGTTTAGTAAAAGGGAGGAAGG + Intronic
1103394264 12:120595985-120596007 AAGAACAGAAAAAGGCAGGCAGG + Intergenic
1103817222 12:123668393-123668415 ATACATAGTAAGAGGCAAGATGG - Intergenic
1105277076 13:18941197-18941219 ATGTGTAGAAAAAGGAAGAAAGG - Intergenic
1105648316 13:22345705-22345727 ATGCATAGTAAATAGCAAGAAGG + Intergenic
1105892723 13:24693355-24693377 ATGGAGAGGAAAAGGGAGGAAGG - Intronic
1106598786 13:31169817-31169839 ATGAAGAGAGAAAGGGAGGAAGG - Intergenic
1107576258 13:41726039-41726061 ATGTTTTGGAAAAGGCAGGAGGG - Intronic
1107771644 13:43793502-43793524 ATGCAAAGAAAATGTCTGGAAGG - Intergenic
1108019385 13:46111115-46111137 ATCCATAGACAAATGCAGGGAGG - Intergenic
1108716097 13:53079289-53079311 ATGCTTAGTAAAGGGAAGGAAGG - Intergenic
1108806334 13:54161306-54161328 ATGCATTGAAAATGGCACAAAGG + Intergenic
1108954412 13:56134673-56134695 ATGCATAAAAATAGGTAGAATGG - Intergenic
1109205416 13:59477830-59477852 ATGCAAAGGACAAGGCATGAAGG - Intergenic
1110227427 13:73134200-73134222 ATACATAGAAAAAAGTTGGATGG + Intergenic
1110692634 13:78449306-78449328 ATGAAGAGAAGAAGACAGGAAGG - Intergenic
1110952629 13:81515762-81515784 ATACAGAGAAAGAGGGAGGAGGG + Intergenic
1111568692 13:90049114-90049136 AGGCATTGAAGAAGGTAGGAAGG - Intergenic
1111596164 13:90414256-90414278 TTGCATAGAAATAGGGAGGGAGG - Intergenic
1111622227 13:90739195-90739217 AAGGAAAGAAAAAGGAAGGAAGG - Intergenic
1111749502 13:92310734-92310756 ATGCCTAGAAAAAGGCAGTAGGG - Intronic
1112150329 13:96753211-96753233 ATGTATATAAAAAGGCAACAAGG - Intronic
1112317227 13:98374019-98374041 ATGCATAGAAAAATTCAGAAAGG - Intronic
1113152179 13:107276115-107276137 ATGAATAGAATATGGCAGAAGGG - Intronic
1113460266 13:110477775-110477797 AGGAATAGACAAGGGCAGGAAGG + Intronic
1114594137 14:23897370-23897392 ATATATAGAAAAAGTCTGGAAGG + Intergenic
1114763580 14:25345076-25345098 ATGCATTGAAGAGGGAAGGAAGG - Intergenic
1115543123 14:34441485-34441507 ATGCATAAACAAAGCAAGGAAGG - Intronic
1115677169 14:35690239-35690261 ATGCATAGAAACAGACAGTGAGG + Intronic
1116228400 14:42182944-42182966 AAGCAAAGAAAGAGGGAGGATGG - Intergenic
1116372505 14:44154340-44154362 ATGCATTGAAGAAGGTAGGAAGG + Intergenic
1117152116 14:52900369-52900391 ATACATATAAAAAAGCATGAGGG + Intronic
1117341723 14:54797762-54797784 ATGCCTAGAAGAGGGCAGGAGGG + Intergenic
1118110705 14:62715766-62715788 ATGTAAAGAAAAAGGAAGGAAGG + Intronic
1118509799 14:66459556-66459578 AAGCATAGAAAATGTCTGGAAGG + Intergenic
1119488972 14:75013761-75013783 ATGGAAGGAAAAAGGAAGGAAGG + Exonic
1120143415 14:80954539-80954561 TTGACTAGAAAAAGACAGGAGGG - Intronic
1120231991 14:81850082-81850104 ATGCACAAACAAAGCCAGGAAGG + Intergenic
1120796445 14:88638333-88638355 AAGAAAAGAAAAAGGCAGAAGGG + Intronic
1121577881 14:95003134-95003156 GTTCCTAGAAAACGGCAGGAGGG - Intergenic
1121709789 14:96029123-96029145 TTACAGAGAAAGAGGCAGGATGG - Intergenic
1121726558 14:96156382-96156404 AAGGAAAGAAAAAGGAAGGAAGG + Intergenic
1124207512 15:27734352-27734374 ATGCATTGAAAAGGGTAGGAAGG + Intergenic
1124815834 15:32991089-32991111 ATGCATAGGAAAAGAAAGGCAGG - Intronic
1124926647 15:34076436-34076458 AGGCAGAGAACAAGGCAGGAGGG + Intergenic
1125460377 15:39901068-39901090 ATTTATTCAAAAAGGCAGGAGGG - Intronic
1125460393 15:39901234-39901256 ATTTATTCAAAAAGGCAGGAGGG - Intronic
1126588937 15:50319976-50319998 ATGCATAGAAAAGATCTGGAAGG - Intronic
1126769031 15:52036784-52036806 AAGGAAAGAAAAAGGAAGGAAGG - Intronic
1127731984 15:61810116-61810138 ATGGAAAGAAAAAGGCATGCGGG + Intergenic
1128111873 15:65081643-65081665 ATACATAGAGAAAGGCAAAACGG - Intergenic
1128909788 15:71503277-71503299 ATGCATGGAAAAATGCTGGGAGG + Intronic
1129011252 15:72419682-72419704 ATGCAAAGAAAAAGGAGGGATGG + Intergenic
1129260480 15:74364612-74364634 ATGCACAGACAAAGTAAGGAAGG - Intronic
1129446940 15:75625403-75625425 ATGCCTAGAAAAAGGCAGTGCGG - Exonic
1130372811 15:83300884-83300906 ATGCAAAGAAAAAGGGAGCATGG - Intergenic
1130552519 15:84899986-84900008 AGGAAAAGAAAAAGGCAGGCAGG + Intronic
1130611907 15:85368940-85368962 ATGAAAAGAATAAGGCAGAAGGG + Intergenic
1130633663 15:85595978-85596000 ATGAAATGAAAGAGGCAGGAAGG - Intronic
1130698508 15:86155486-86155508 ATACAGATAAAAAGTCAGGAGGG + Intronic
1130819289 15:87477275-87477297 ATGGAATGGAAAAGGCAGGAAGG - Intergenic
1131196161 15:90356597-90356619 ATGCTTAGAAAAATGCTGGTAGG - Intronic
1131449316 15:92525979-92526001 ATGGAGGGAAAAAGGAAGGAAGG - Intergenic
1131970370 15:97886436-97886458 ATGCATAGAAAATGTCTGAAAGG + Intergenic
1132334714 15:101038835-101038857 TTGCACAGAAGAAGGCAAGATGG - Intronic
1133000068 16:2845824-2845846 ATGAATTGCAAAAGGAAGGAGGG - Intergenic
1133781713 16:8944140-8944162 ATGCAAGCAAAAAGGCAAGAAGG - Intronic
1133812494 16:9171499-9171521 ATACATATAAATAGGTAGGATGG + Intergenic
1134077682 16:11303523-11303545 ATGCATACTAAGAGGCAGAATGG + Intronic
1134766805 16:16766343-16766365 ATGTATAGAGAGAGGCAGCAAGG + Intergenic
1134827136 16:17293906-17293928 ATGCAGAGCAGAAGACAGGAGGG + Intronic
1134867274 16:17619752-17619774 AAGGAGAGAAAAAGGAAGGAGGG - Intergenic
1134908060 16:17999100-17999122 AGGCATTCAAACAGGCAGGATGG + Intergenic
1135773736 16:25237676-25237698 AATGATAGAAAAAGGAAGGAAGG - Exonic
1135787843 16:25366431-25366453 AAGCACAGAGAAAGACAGGAAGG - Intergenic
1137261629 16:46834873-46834895 ATGCAAAGAAAAAGTCTTGAAGG - Intergenic
1137348716 16:47690916-47690938 ATGCATTGAAAAGGGCATGATGG + Intronic
1137720789 16:50626195-50626217 ATGCAAAGACACAGGCAGGAAGG - Intronic
1138047522 16:53741279-53741301 ATGCACAGAAAAAGTCTTGAAGG - Intronic
1138154064 16:54686167-54686189 ATAAAAAGAAAAAGGAAGGAAGG - Intergenic
1138621294 16:58213188-58213210 AAGGAAAGAAAAAGGAAGGAAGG + Intergenic
1138832594 16:60393236-60393258 AGGAATAAACAAAGGCAGGATGG - Intergenic
1139118299 16:63984217-63984239 ATGCATAGTAAAACGAAGCATGG + Intergenic
1139253543 16:65519623-65519645 AAGGAAAGAAAAAGGAAGGAGGG - Intergenic
1140465045 16:75174774-75174796 ATGCATTGAAGAGGGCACGAAGG + Intergenic
1140543764 16:75786027-75786049 AAGCATAGATGAAGGGAGGAAGG - Intergenic
1140683040 16:77404044-77404066 AAGCAGAGGAAAAGGGAGGAAGG - Intronic
1140802396 16:78500412-78500434 ATGAAGGGAAAAAGGAAGGAAGG - Intronic
1141304831 16:82852439-82852461 ATCCATGGAAATAGGAAGGAAGG - Intronic
1141484781 16:84331527-84331549 ATGCAAATACCAAGGCAGGAAGG + Intergenic
1203048949 16_KI270728v1_random:857157-857179 ATACAGAGAAAAAGCTAGGATGG - Intergenic
1142515391 17:424690-424712 ATTAATAGAAAAAGGCTGGAAGG - Intergenic
1142594788 17:1024242-1024264 GTGCATAGCAACAGGCAAGACGG - Intronic
1142658439 17:1410492-1410514 AAAGAAAGAAAAAGGCAGGAAGG - Intergenic
1142668497 17:1475968-1475990 ATGCATAGAAAAAGGCAGGAGGG + Intronic
1142700673 17:1658427-1658449 ATGCTGGGAAGAAGGCAGGATGG - Intronic
1142823331 17:2490111-2490133 ATGCAGAGGAAAAGTCTGGAAGG + Intronic
1144276557 17:13674440-13674462 AAGGATAGAAAAAGGTAGAAAGG + Intergenic
1144377600 17:14660988-14661010 CTGCATAAAAAAAGATAGGAAGG + Intergenic
1144389151 17:14777565-14777587 ATGCACAGTAACAGGCAGCAGGG - Intergenic
1144860929 17:18301411-18301433 AGGGATAGAGAAAGGCCGGAGGG - Intronic
1145739625 17:27262353-27262375 ATGCTTAGAATAAGGGAAGAAGG + Intergenic
1147347350 17:39809693-39809715 ATCCATAGAAAAATGCTGAATGG - Intronic
1148326464 17:46786101-46786123 AAGCCTGGAAAAAGGGAGGAGGG + Intronic
1148947982 17:51282462-51282484 ATGAAGAGAAAGAGGAAGGAAGG + Intronic
1148982960 17:51595145-51595167 ATGTATAGAAAATGGAAGGAAGG + Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1150133995 17:62685302-62685324 TTCCATGGAAAAAGGCAGGAAGG - Intronic
1150352667 17:64458123-64458145 AGGCATACAAGAAGGAAGGAAGG - Intronic
1150557078 17:66263886-66263908 AAGAAAAGAAAAAGGAAGGAAGG + Intergenic
1150582506 17:66487645-66487667 ATGCAGAGAAAAGGGAAGGCAGG - Intronic
1150895552 17:69206484-69206506 ATGCATTGAAGAGGGCAGAAAGG + Intronic
1151630810 17:75309614-75309636 AAGCAGAGAGAAAGGCTGGAGGG - Intergenic
1152009788 17:77705358-77705380 GTGCATAGAAAATGCCTGGAAGG + Intergenic
1152055177 17:78019074-78019096 AAGCATAGTGAAAGGAAGGAAGG + Intronic
1152434792 17:80269514-80269536 ATGAATAGAAAGAGGATGGATGG - Intronic
1152446473 17:80347611-80347633 CTGCATGGAAACAGGCAAGATGG + Exonic
1203173813 17_GL000205v2_random:176273-176295 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153455408 18:5276085-5276107 TCTCATAGCAAAAGGCAGGAGGG - Intergenic
1153572125 18:6483814-6483836 AGGCATAGAACAGGGAAGGAGGG + Intergenic
1154405353 18:14085597-14085619 AGGCATTGAAGAAGGTAGGAAGG + Intronic
1155352711 18:24922586-24922608 ACACATAAAAAATGGCAGGAAGG + Intergenic
1155587683 18:27386428-27386450 ATGAATGGAAAAAAGGAGGAAGG - Intergenic
1155614354 18:27703582-27703604 TTGCCTAGAACAAGGGAGGAAGG + Intergenic
1155755714 18:29493003-29493025 TTACATAGCAGAAGGCAGGAGGG + Intergenic
1155915257 18:31551213-31551235 ATGGATAGAAAAAGGAAGTGAGG - Intergenic
1156204121 18:34867574-34867596 GTGCATAGAAAAAGGAAATAAGG + Intronic
1156336493 18:36177458-36177480 ATGCATAGAAACAAGTAGAATGG + Intronic
1156548410 18:37988989-37989011 CTGCATAGAAAAGGGCAGGAGGG - Intergenic
1156684088 18:39623245-39623267 ATGCACAGTAAAAGGCAAAATGG + Intergenic
1156774340 18:40769251-40769273 ATGGACAGAATAAGGCAAGATGG - Intergenic
1156792559 18:40993615-40993637 ATGCATATAAAATGGCAACATGG - Intergenic
1157401734 18:47394268-47394290 ATGCATAGCACCAGGCAGGTAGG + Intergenic
1157419685 18:47535969-47535991 ATGCATAGAGGAGGGCAGGAGGG + Intergenic
1157561288 18:48648245-48648267 ATTCAAAGAAAAAGGGAGCATGG + Intronic
1158243608 18:55405751-55405773 AGGAAAAGAAAGAGGCAGGAGGG + Intronic
1158370635 18:56798952-56798974 AGGGAAAGAAAAAGGGAGGAAGG - Intronic
1158654044 18:59312730-59312752 TTACACAGAAAAAGGCAGAAAGG - Exonic
1159625726 18:70691811-70691833 ATGCCTAGAATGAGGCAGGGAGG - Intergenic
1160761885 19:789599-789621 AGCCAGAGAGAAAGGCAGGAAGG - Intergenic
1161622795 19:5308076-5308098 ATGCAGAGAAAAATGCATGGTGG - Intronic
1161753956 19:6117787-6117809 AAGAAAAGAAAAAGGAAGGAAGG + Intronic
1162155990 19:8678257-8678279 ATGCATGGATAAATGGAGGATGG - Intergenic
1162539595 19:11286599-11286621 ATAAATAAAAAAAGGAAGGAAGG + Intergenic
1164207784 19:23072220-23072242 ATGTTGAGAGAAAGGCAGGAAGG + Intergenic
1164782452 19:30903972-30903994 AAGAAAAGAAAAAGGAAGGAAGG + Intergenic
1164905189 19:31961374-31961396 GTGCACAGAAGAAGGGAGGAGGG - Intergenic
1165784779 19:38454931-38454953 ATGGAGAGAAAAGTGCAGGAAGG + Intronic
1165942940 19:39424354-39424376 ATGCCAAGACAAAGGCTGGATGG - Exonic
1166397923 19:42456038-42456060 AGGCATGGAAAGAGGCAGGTGGG + Intergenic
1166550807 19:43664920-43664942 ATACATACAAACATGCAGGATGG + Intronic
1167375119 19:49107094-49107116 ATGCACAGACACTGGCAGGAAGG + Intronic
1168258152 19:55178467-55178489 ATGCAATGAAAATGGCTGGAGGG - Intronic
1168486314 19:56765227-56765249 ATGCCTGGGAAAAGGCAGGCCGG + Intergenic
925113727 2:1359490-1359512 ATGCAAACAAAAGGGCAGGGTGG - Intronic
926419467 2:12682467-12682489 GTGTAGAGAAAAAGACAGGAAGG + Intergenic
926771761 2:16384179-16384201 AGGCATATAAACAGGCTGGAAGG + Intergenic
927941486 2:27105845-27105867 ATGCATAGAAAAATGAAGACGGG - Intronic
928124604 2:28606860-28606882 ATGCCAGGAAAATGGCAGGAGGG + Intronic
928158862 2:28902678-28902700 ATGCAAATAAAGAGACAGGAAGG + Intronic
928219029 2:29387405-29387427 GTCCATCAAAAAAGGCAGGAGGG + Intronic
929321193 2:40545362-40545384 AAGTATAGGAAAAGGAAGGATGG - Intronic
929661709 2:43792693-43792715 ATTCATAGAGACAGGCAGTAGGG - Intronic
929736752 2:44557587-44557609 ACACATAGAAGAAGGGAGGAAGG - Intronic
929860323 2:45671546-45671568 AGGCAAAGAATAAGGTAGGAAGG - Intronic
930378908 2:50602594-50602616 AGGGAGAGAAAAAGGAAGGAAGG - Intronic
930986501 2:57594465-57594487 ATGTAGAGAAAAAGGCAGATTGG - Intergenic
932249929 2:70234372-70234394 ACCCATAGAGAAAGACAGGAGGG - Intronic
932830577 2:74985813-74985835 TTGCATACAAAAAGGTTGGAAGG - Intergenic
933071672 2:77866096-77866118 ATGCAGTGGAGAAGGCAGGAGGG - Intergenic
933127406 2:78626511-78626533 ATGAATAAAAAATGGGAGGAAGG + Intergenic
933361893 2:81297429-81297451 ATGGAGAGAAAAAGGAAAGAAGG - Intergenic
933379479 2:81524555-81524577 AGGAAAAGAAAAAGGGAGGAAGG - Intergenic
933973973 2:87493009-87493031 ATGCACAGAATAAGTCAGAAAGG - Intergenic
934636635 2:95995320-95995342 ATGCTTAGAAAAAGGCATGATGG + Intergenic
934797013 2:97110101-97110123 ATGCTTAGAAAAAGGAATGATGG - Intergenic
934836401 2:97593326-97593348 ATGCTTAGAAAAAGGAATGATGG + Intergenic
935809851 2:106786969-106786991 GTGACTAGAAAAAGGAAGGAGGG - Intergenic
935874313 2:107489132-107489154 AAGCATAGAAAGAGCCTGGATGG - Intergenic
936021375 2:108997531-108997553 ACAGATAGAAAGAGGCAGGATGG + Intergenic
936319748 2:111457195-111457217 ATGCACAGAATAAGTCAGAAAGG + Intergenic
936545402 2:113388121-113388143 TTGCTTAGAAAAAGGCATGACGG - Intergenic
936975047 2:118210534-118210556 ATGGATAGAAAAAGGCAGACTGG + Intergenic
937486499 2:122320671-122320693 ATGACTAGACAAAGGAAGGAAGG - Intergenic
937610002 2:123849869-123849891 AGGAATAAAAAAAGGAAGGAAGG + Intergenic
938872416 2:135494088-135494110 ATGGATAGAAATAGAAAGGAGGG + Intronic
939229404 2:139407105-139407127 ATATAAAGAAAAAGGAAGGAAGG + Intergenic
939598430 2:144157447-144157469 AAGCAGAGAAAAAGGAAGAAGGG - Intronic
940172816 2:150847159-150847181 ATGTAGGGAAAAAGGAAGGAAGG - Intergenic
940482413 2:154251823-154251845 GTGCATAGAATAAGGAAGAAAGG + Intronic
940647145 2:156403502-156403524 CTGCATAAAAAATGTCAGGATGG - Intergenic
940951647 2:159682156-159682178 AAGCAAAGAAAACAGCAGGAGGG - Intergenic
940985883 2:160051830-160051852 ATGCAGAGAGAGAGGTAGGAAGG - Intronic
942379967 2:175379782-175379804 TTGCATAGAAAAAAGTTGGAAGG - Intergenic
942964741 2:181877955-181877977 ATGCACAATAAAAGGAAGGATGG - Intergenic
943180954 2:184540384-184540406 AGGGATGGAAAAAGGGAGGAAGG + Intergenic
943883857 2:193185509-193185531 ATCCATCACAAAAGGCAGGAGGG - Intergenic
944161409 2:196664476-196664498 ATGCATAGAGCAAGGCATGTGGG + Intronic
944373498 2:199012466-199012488 ATGCATTGAAGAAGGTAGGAAGG - Intergenic
944665354 2:201954811-201954833 ATACATAAAACATGGCAGGAGGG + Intergenic
945043647 2:205763434-205763456 ATACCGAGAAATAGGCAGGAGGG + Intronic
945356452 2:208844843-208844865 ATGCATTGAAAAAGGTTAGAAGG + Intronic
945395564 2:209311695-209311717 ATGAATAGGAGAAGGCAAGAAGG + Intergenic
945438197 2:209844539-209844561 TTGGAAAGAAAAAGGAAGGAAGG - Intronic
945804185 2:214470019-214470041 AAGCAAAGCAAAAGGCAGAATGG + Intronic
945856815 2:215079003-215079025 ATGCATAAAAAAGGACAAGAGGG - Intronic
946051263 2:216864362-216864384 TTGCAGAGCAAAAGGGAGGAAGG + Intergenic
947216392 2:227753992-227754014 ATGAGAAGAAAAAGGCAGGCCGG - Intergenic
948300584 2:236903868-236903890 GAGCAGAGAAAAAGTCAGGAGGG - Intergenic
948349689 2:237328489-237328511 ATTCATAGAAAAAAATAGGAAGG + Intronic
948565515 2:238883945-238883967 ATGCAGAGGAGAAGGAAGGACGG - Intronic
1168988710 20:2074796-2074818 AAGAAAAGAAAAAGGAAGGAAGG + Intergenic
1169079930 20:2791624-2791646 ATAAAAAGAAAAAGGAAGGAAGG + Intergenic
1169792572 20:9427307-9427329 CTGCTTAGAAACAGCCAGGAAGG - Intronic
1169914739 20:10673875-10673897 CTGCATGGAAAAAGGGGGGAGGG + Exonic
1170546638 20:17440390-17440412 ATGAATAGAAAAGGGCAGCAGGG + Intronic
1171101311 20:22385867-22385889 GGGCAGAGAAAAAGGCGGGAGGG - Intergenic
1171328022 20:24312926-24312948 ACTCATAGCAAAAGGCAAGATGG + Intergenic
1172023040 20:31928340-31928362 ATAAATAGAAAACTGCAGGAAGG + Intronic
1172619596 20:36310253-36310275 TTGCATGGATAAAGGCAGGAAGG + Intronic
1172670271 20:36630268-36630290 CTGCCTAGAAAATAGCAGGAGGG + Intronic
1173029932 20:39347513-39347535 ATGCATTGAAAACGGTAGAAAGG + Intergenic
1173384498 20:42575162-42575184 ACACATAGAAAGACGCAGGAAGG + Intronic
1173502989 20:43566945-43566967 AAGAAAAGAAAAAGGCAGGCAGG + Intronic
1174187529 20:48717220-48717242 ACAAAGAGAAAAAGGCAGGAGGG + Intronic
1174193272 20:48755259-48755281 AGGCATAGAAAAATGAAGTATGG + Intronic
1174602212 20:51733972-51733994 AAGAAAAGAAAAAGGCATGAGGG - Intronic
1175126962 20:56759705-56759727 AGGCAAAGAAAAAGGCAGGTGGG - Intergenic
1175467937 20:59205230-59205252 GTGCAGAGACAAAGGGAGGAAGG - Intronic
1176329802 21:5537919-5537941 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1176397955 21:6283032-6283054 ATGCAGAGAAAAAGAGAGAAAGG - Intergenic
1176439202 21:6706072-6706094 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1176463464 21:7033141-7033163 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1176487025 21:7414920-7414942 ATGCAGAGAAAAAGAGAGAAAGG + Intergenic
1177303175 21:19277085-19277107 ATGCATAGGGAAAGGTATGAGGG + Intergenic
1177947049 21:27483452-27483474 ATCCAAAGAAGAAGGCAGCATGG + Intergenic
1178401177 21:32286072-32286094 AAGAAAAGAAAAAGGAAGGAAGG + Intergenic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178527181 21:33340786-33340808 ATGCATTGAAAAAGAGTGGAAGG + Intronic
1178809638 21:35869651-35869673 ATGGATACAAAATGGCAGAAAGG + Intronic
1178914844 21:36700398-36700420 ATGCATTGGCAAAGGAAGGAAGG - Intronic
1178988343 21:37328663-37328685 ATGTTTAGAAAAAGGCAAGTGGG - Intergenic
1179163435 21:38916697-38916719 AGGAAGAGAAAAAGGAAGGAAGG + Intergenic
1179482411 21:41686546-41686568 GTGAATGGAAAAAGGGAGGAAGG + Intergenic
1180161981 21:46002195-46002217 CTGCATAGCAAAGGGCAGGAAGG - Intronic
1180715951 22:17872433-17872455 ACACATGGAAGAAGGCAGGAAGG + Intronic
1181380015 22:22494687-22494709 ATGCATAGAAATAATCTGGAAGG - Intronic
1181713825 22:24709275-24709297 ATGCATAGATAAAGACAACATGG - Intergenic
1182640704 22:31764745-31764767 ATGGAGAGAAAAAGGGAGAAGGG - Intronic
1182799288 22:33018341-33018363 AAGCCTAGGAAAAGACAGGAAGG + Intronic
1183317833 22:37146581-37146603 CTTCATGGAAAAAGGCATGAGGG - Intronic
1183451597 22:37898929-37898951 ATGCCTAGAACATGCCAGGACGG - Intergenic
1184186555 22:42868890-42868912 CTGCAGAGAAACAGGCAGAACGG - Intronic
1185308229 22:50135376-50135398 ATGCATGGAAAATGTCTGGAAGG + Intronic
950141323 3:10618018-10618040 ATATATAGATAAAAGCAGGAAGG + Intronic
950170285 3:10834381-10834403 TTTCATAGGAAAAGGGAGGAAGG + Intronic
950375580 3:12569595-12569617 CTGCAGAGAAAAAGGAGGGAAGG - Intronic
952346939 3:32496924-32496946 ATGTTTAGATGAAGGCAGGAGGG + Intronic
952677973 3:36055814-36055836 ATGAGTAGAAATAGGCAGGCTGG + Intergenic
953013979 3:39054879-39054901 ATGCATTTTAAAAGTCAGGAAGG + Intronic
953459593 3:43072010-43072032 ATGAATATAAGAAGGAAGGAAGG - Intergenic
953479402 3:43237177-43237199 ATGCAGAGAAAAAGACAAGAAGG - Intergenic
953506512 3:43490993-43491015 ATGCATATTAAGAGGCAGAATGG + Intronic
953747419 3:45585764-45585786 ATCCATAGTAACAGGAAGGAAGG - Intronic
953849042 3:46451082-46451104 AGGCAGGGAATAAGGCAGGAAGG + Intronic
953880941 3:46691000-46691022 CTGCAGAGAGAGAGGCAGGAAGG + Intronic
954071719 3:48147787-48147809 ATGCATAGAAAAGGTCTAGAAGG + Intergenic
954854920 3:53635719-53635741 ATGAATAGCAGAAGGCAGGATGG - Intronic
954955372 3:54513971-54513993 GTGCATATAAACAGGCATGACGG - Intronic
954992810 3:54855582-54855604 ATGCAAAGAAAAGTGAAGGAGGG + Intronic
955072962 3:55587142-55587164 AAGAAAAGAAAAAGGAAGGAAGG - Intronic
955176368 3:56618142-56618164 ATGGATAGATAAATGCAGAAAGG - Intronic
955470171 3:59278541-59278563 AAGCATAGAAGATGGGAGGAAGG - Intergenic
955653820 3:61222638-61222660 ATGAAAAGAAAAAGAAAGGAAGG + Intronic
955968323 3:64411571-64411593 TAGAATAGAAAAAGTCAGGACGG - Intronic
956043216 3:65168601-65168623 ATTCTTAGAATAAGGCCGGAAGG - Intergenic
956484469 3:69707621-69707643 AAGAATATAAAATGGCAGGAGGG + Intergenic
956819993 3:72945568-72945590 ATGAAGAGAAAATGGAAGGAAGG + Intronic
957517787 3:81278237-81278259 AGGAATAGAAAAAGGTAAGATGG + Intergenic
957651543 3:83012831-83012853 ATGGAAAGAAAAAGGGAGAAAGG - Intergenic
958095831 3:88942963-88942985 ATGCATACAAAAAGGTATGGGGG - Intergenic
958526844 3:95271940-95271962 ATAAATAGAAAAAGAAAGGAGGG - Intergenic
958752194 3:98204566-98204588 ATGCAAAGAGAGAAGCAGGAAGG - Intergenic
958787674 3:98615436-98615458 AGGCTTAGAAAAAGGGAGGCTGG + Intergenic
958999088 3:100940612-100940634 ATGCAGTGAAAAGGGCAGGATGG - Intronic
959445305 3:106432099-106432121 AAAAATAGAAAAAGGCAGAAGGG - Intergenic
959590055 3:108069426-108069448 ATGAATAGAAAAAGACAGAAAGG + Intronic
959630156 3:108498671-108498693 TTGTATAGATAAAGGCAGGCAGG - Intronic
960131300 3:114058893-114058915 ATGCATAGAAAAATGACTGAAGG - Intronic
960902352 3:122565110-122565132 ATTCATAAAAAAAGGCAGGAAGG - Intronic
961578680 3:127859844-127859866 ATTCATAGAAAATGACTGGAAGG + Intergenic
961720765 3:128894465-128894487 ATGCCTAGAAAAAGTGTGGATGG + Intronic
961845222 3:129757258-129757280 AAGGAAAGAAAAAGGGAGGAAGG - Intronic
961865929 3:129953495-129953517 AGGGAAAGAAAAAGGAAGGAAGG - Intergenic
962037440 3:131667604-131667626 AAGGAAAGAAAAAGGAAGGAAGG - Intronic
962609819 3:137065623-137065645 AGGCATAGACAAAGGCAGGTGGG + Intergenic
964033761 3:152170222-152170244 ATGGATAGAAAAACTCAGGGAGG - Intergenic
964129866 3:153274692-153274714 AGGCATGGAGAAAGTCAGGAAGG + Intergenic
964786739 3:160403925-160403947 ATTCAAAGAAAAAGGAAGGAAGG - Intronic
965496187 3:169401846-169401868 ATGCAGAGAAAGAGGCAGTGAGG + Intronic
965683234 3:171273472-171273494 ATGCATTGAAGAGGGTAGGAGGG - Intronic
967082620 3:186064308-186064330 AAGCAAAGAAAGAGGAAGGAAGG + Intronic
967103512 3:186236561-186236583 ATTTATAGAAGAAGGCAGCAGGG - Intronic
967116644 3:186347020-186347042 ATGCAAACAAAAAGAAAGGAGGG - Intronic
967338066 3:188366490-188366512 ACGCATTGAGGAAGGCAGGAAGG - Intronic
969157035 4:5219947-5219969 ATTCATAGCTAAAGGCAGGATGG + Intronic
969505175 4:7581911-7581933 ATATATAGAAAAAGACAAGAAGG - Intronic
970587199 4:17526070-17526092 ATTCATAGAAAAAGGAAAGGAGG - Intronic
970595025 4:17592219-17592241 ATGACTACAAAAAGGCAGAAGGG - Intronic
970977583 4:22058669-22058691 ATGCATAGGAGAAGGTATGAAGG + Intergenic
971170009 4:24224257-24224279 ATCCATAGAAAGAGGGAGAATGG + Intergenic
971790138 4:31159597-31159619 AAGAAGAGAAGAAGGCAGGAAGG + Intergenic
971988639 4:33862553-33862575 ATTCATAGAAAAAAAAAGGATGG + Intergenic
972232808 4:37095177-37095199 CTGCACAGCAAAAGGCAGGTTGG + Intergenic
972237223 4:37148516-37148538 TTCCCTAGAAAAAGACAGGAGGG - Intergenic
972329706 4:38053826-38053848 ATGCACAGAAGAGGGCAGAATGG + Intronic
972357862 4:38298114-38298136 ATGCATTGAAGAGGGTAGGAAGG + Intergenic
972424010 4:38915687-38915709 ATGAATAGCAAAAGTCAGCAGGG + Intronic
972864989 4:43220855-43220877 ACACATAGAACAAGGCAGAATGG - Intergenic
973125478 4:46578583-46578605 TTTGATAGAAAAATGCAGGAAGG + Intergenic
973830954 4:54758199-54758221 AGAGATAGAAAATGGCAGGATGG + Intergenic
974787502 4:66638701-66638723 TTGAATAGAAATAGGAAGGAAGG + Intergenic
974802393 4:66835027-66835049 AAGAAAAGAAAAAGGAAGGAAGG - Intergenic
975361850 4:73479602-73479624 ATGTGTAGAAAATGGCAGGGTGG - Intergenic
975642004 4:76510253-76510275 ATGCATTAAAAAAGGCTGAAAGG + Intronic
975875201 4:78828112-78828134 ATGGCTAGAATAAAGCAGGAAGG + Intronic
975889190 4:79004688-79004710 ATGCATAGGCAATGGAAGGATGG - Intergenic
976483306 4:85570131-85570153 ATTCATTTAAGAAGGCAGGAGGG + Intronic
977447769 4:97152972-97152994 ATTCATAGTGAAAGGCATGAAGG - Intergenic
977528746 4:98175071-98175093 AAGTAAAGAAAAAGGCAGGTGGG + Intergenic
978277364 4:106968004-106968026 ATGGAGAGATGAAGGCAGGAAGG + Intronic
978979295 4:114922241-114922263 ATGCACAGTAAGAGGCAAGATGG + Intronic
978992960 4:115109118-115109140 AAGAATAGAAAAAGAGAGGAAGG + Intronic
979187679 4:117818828-117818850 ATGGCTAGAAAAAAGCAGGCAGG + Intergenic
979238668 4:118429263-118429285 ATGCATGGAAAAAGAAAGGTAGG - Intergenic
979375047 4:119936772-119936794 ATGCATTGAAAACGGGAGGAAGG - Intergenic
979764698 4:124449726-124449748 AGGCAGAGAGAAAGGCGGGAGGG - Intergenic
979793305 4:124813705-124813727 AAGAAGAAAAAAAGGCAGGAAGG - Intergenic
980670008 4:135993430-135993452 ATGGAAAGAAGAAGGAAGGAAGG - Intergenic
980775258 4:137428917-137428939 ATGTAAAAAAGAAGGCAGGAAGG - Intergenic
980907752 4:138964649-138964671 ATATATAGAAAAAGTCTGGAGGG - Intergenic
981308836 4:143275721-143275743 ATCCATTGAAAAACCCAGGATGG - Intergenic
981452069 4:144910198-144910220 ATGCATATAAAAAGGTAAAAAGG - Intergenic
981458338 4:144982319-144982341 ATGCAAGGAAGAAGGCAGCATGG - Intronic
981819686 4:148871681-148871703 ATTCATAGAAACAGAAAGGATGG + Intergenic
982500778 4:156152337-156152359 ATGCTGAAAAAAAGGAAGGAGGG - Intergenic
982669445 4:158302566-158302588 ATGCATATTGAAAGGCAGGGTGG - Intergenic
983010167 4:162537282-162537304 ATGCAGTGAAAAAGGAAGGAGGG + Intergenic
984327301 4:178270743-178270765 ATACATAGAAAAAGAAAGAAAGG + Intergenic
984767072 4:183407974-183407996 AAGGAAGGAAAAAGGCAGGAAGG - Intergenic
984863710 4:184262667-184262689 ATATATAGAAAAAAGCTGGAGGG + Intergenic
984890258 4:184485759-184485781 CTGCAAAGAAACAGGCTGGAGGG + Intergenic
986283726 5:6344945-6344967 ATGACTAGAGAAAGGCAGGGTGG + Intergenic
986344093 5:6818413-6818435 ATACATAAAAACAGGCTGGAAGG - Intergenic
986796534 5:11218066-11218088 ATGAAGAGGAAAAGGAAGGAAGG - Intronic
986843563 5:11726404-11726426 ATTCATATAAAAAGTCTGGAAGG + Intronic
987142225 5:14958161-14958183 ATGCATAGGATAGGGTAGGATGG - Intergenic
987769983 5:22289656-22289678 ATGCATTGAAGAAGGAAGGTAGG + Intronic
987873916 5:23655536-23655558 ATGCATTGAAGAGGGTAGGAAGG + Intergenic
988015355 5:25550434-25550456 ATAAATAGAAAAATGAAGGAAGG - Intergenic
988541241 5:32111970-32111992 ACGCAAGGAAAAAGGCAAGATGG + Intergenic
988819727 5:34869781-34869803 AAGCATTGAAAAAAGTAGGATGG - Intronic
988871326 5:35393488-35393510 ATGCATAGAAAACCTCTGGAAGG - Intergenic
989734634 5:44689106-44689128 AAAGAAAGAAAAAGGCAGGAAGG + Intergenic
989979181 5:50621873-50621895 AAGAAAAGAAAAAGGAAGGAAGG + Intergenic
989995753 5:50828581-50828603 ATGAAAAGAAAAAGAAAGGATGG + Intronic
990122788 5:52475982-52476004 AAGCAGGGAAAATGGCAGGATGG + Intergenic
990172044 5:53062377-53062399 TGTCATAGCAAAAGGCAGGAGGG - Intronic
990254812 5:53956404-53956426 ATGCAAAGAAAGAGGAAGTATGG + Intronic
990254814 5:53956442-53956464 ATGCAAAGAAAGAGGAAGTATGG - Intronic
990336036 5:54773773-54773795 ATTCATAGAAAAATGGAGTAAGG - Intergenic
990425377 5:55682937-55682959 AAGAATAGAAGAAGGAAGGAAGG + Intronic
990491601 5:56308395-56308417 AAGCATATCAAAAGGCAAGATGG - Intergenic
991347803 5:65688452-65688474 ATGCACAGAAACATGCAAGAAGG + Intronic
991409809 5:66334796-66334818 ATGCTCAGAAATAGACAGGATGG - Intergenic
991473223 5:66991879-66991901 ACACACAGAAAAAAGCAGGAAGG - Intronic
992847289 5:80763749-80763771 AAGTTTACAAAAAGGCAGGAAGG - Intronic
993427067 5:87779082-87779104 TTTCATAGAAAAAGGCATGTAGG - Intergenic
993547577 5:89230630-89230652 ATGCTTTGAAGAAGGCAGAAAGG - Intergenic
993772906 5:91953244-91953266 TTGCAAAGAAAAAGGAAGAAGGG + Intergenic
994240809 5:97418673-97418695 GGCCAAAGAAAAAGGCAGGATGG + Intergenic
995054871 5:107747739-107747761 ATGCACACAAGAAGGCAAGAAGG - Intergenic
995138734 5:108708673-108708695 ATACATAGAAAAATTCAAGAAGG + Intergenic
995461316 5:112406264-112406286 ATGCAGAGAAGAAAGCAGAAAGG - Intronic
995791715 5:115895503-115895525 ATACATAGAAAAGGAGAGGATGG + Intronic
995795615 5:115938160-115938182 ATGGATAGAAAAAAGTAGGAAGG - Intergenic
995835204 5:116394018-116394040 ATGAATAGAAGAAGGAAAGAAGG + Intronic
996353124 5:122567716-122567738 CTGCATCAAAAAAGGCAAGAAGG + Intergenic
999461876 5:151763962-151763984 ATGCATTTAAAAAGTCAGGATGG - Intronic
999468096 5:151826055-151826077 ATGCATAGAAGGAGGCAGGCAGG + Intronic
999800094 5:155025610-155025632 ATGCAAAGAATAAGGCAAGAAGG - Intergenic
1000299465 5:159942770-159942792 ATACATAGAAAAAAACTGGAAGG + Intronic
1000423555 5:161064217-161064239 CTGCCTAGAACAAGGCAGCAGGG + Intergenic
1001112367 5:168907452-168907474 CTGCAAAGAAAAGGCCAGGAAGG + Intronic
1001222859 5:169917659-169917681 ATGCATAGAAAGAGAAATGAAGG + Intronic
1001238753 5:170051826-170051848 ATAAATAGAGAAAGGGAGGAAGG + Intronic
1001465803 5:171965017-171965039 ATGCAGAGAAGTAGGCAGGAAGG + Intronic
1001583554 5:172817294-172817316 ATGCAGAGAAAAAAGTTGGAAGG + Intergenic
1001828979 5:174769200-174769222 ATAAAGAGAAAAAGGAAGGAAGG + Intergenic
1002739085 5:181421232-181421254 ATGCATGGAAAAAGAAAGGTAGG - Intergenic
1002970257 6:2009523-2009545 ATGCTTTTTAAAAGGCAGGAGGG + Intronic
1003063884 6:2885627-2885649 AAGGAAAGAAAAAGGAAGGAAGG - Intergenic
1003360982 6:5424994-5425016 GTGGAAAGAAAAAGGAAGGAGGG - Intronic
1003823558 6:9927370-9927392 ATGCACAGGAAAAGGAAGGGAGG - Intronic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1004212309 6:13661368-13661390 AAGCATAGAAAAAGACAGATGGG + Intronic
1004668360 6:17770880-17770902 TTGCTTAGAAAAAGGGAGAAAGG - Intronic
1004892099 6:20110661-20110683 ATGAATAGAAAAAGCTTGGATGG - Intronic
1005060536 6:21773176-21773198 ATGCATTGGAAAAAGCAGAAAGG + Intergenic
1005092959 6:22078468-22078490 ATGCATAGGGATGGGCAGGAAGG + Intergenic
1005995605 6:30929374-30929396 GAGCATAGAAAATGGCAGGGTGG - Intergenic
1006446333 6:34081783-34081805 ATGCAGAGAAAAAGGCAGCTGGG + Intronic
1006594727 6:35184798-35184820 ATGCAGAGAAAAAGACAGGTAGG - Intergenic
1007176081 6:39898687-39898709 ATGCACAGACAGAGGCATGAAGG + Intronic
1007743806 6:44029938-44029960 TTGGATAGAAAGAGGCAAGATGG - Intergenic
1007875659 6:45098126-45098148 AGCCAAAGAAAAAAGCAGGAAGG + Intronic
1007906413 6:45465944-45465966 AGGCATAGAAAAAAGAAGTAGGG - Intronic
1008068339 6:47074133-47074155 ATGAATAGAAAAAGGCCATAAGG + Intergenic
1008068623 6:47076510-47076532 ATGAATAGAAAAAGGCCACAAGG - Intergenic
1008812566 6:55521935-55521957 ATGCAAAGAAAAAGTCAGAAGGG + Intronic
1009158380 6:60250877-60250899 ATGAATATAAAAAGTCAAGAAGG - Intergenic
1009293458 6:61913427-61913449 ATGCATTCCAAAGGGCAGGAAGG + Intronic
1010352670 6:74893446-74893468 AGGAATAAAAAAAGGAAGGAAGG + Intergenic
1011734988 6:90301584-90301606 ATGCATAGGAAAAATCTGGAAGG + Intergenic
1011812082 6:91144398-91144420 AAGCACAGAAGAAGGAAGGAAGG - Intergenic
1011851788 6:91638457-91638479 ATGGATAGCTAAAGGAAGGAAGG + Intergenic
1012140095 6:95616116-95616138 ATCCATAGTCAAAGGCAGAAAGG - Intergenic
1012612479 6:101232744-101232766 ATGCATAAAAAAGAGCTGGAAGG - Intergenic
1013229243 6:108146608-108146630 ATTTATAGAGCAAGGCAGGAAGG - Intronic
1013732938 6:113190398-113190420 AGGCACAGAACAAGGCAGGGAGG + Intergenic
1013775226 6:113672225-113672247 AAGGAAAGAAAAAGGAAGGAAGG + Intergenic
1013921559 6:115411338-115411360 AAGCATTGAAAAAAGCAGGCTGG + Intergenic
1014325353 6:119986598-119986620 TTGCATAGAAACAGGATGGAGGG - Intergenic
1014334125 6:120110167-120110189 AAGCATAGAAGAAGGAAGAAAGG + Intergenic
1014365047 6:120529345-120529367 ATGAATAGAGACAAGCAGGATGG - Intergenic
1014762698 6:125375137-125375159 ATGGAGAGAAAAAGGAAGAAGGG - Intergenic
1015320856 6:131872435-131872457 AGGCATAAAAAAAGACTGGAAGG - Intronic
1015377511 6:132527546-132527568 AAGAATAGAAAAAGCCATGAAGG - Intergenic
1015482585 6:133729429-133729451 ATGCATTGAAAAGGGAAGGCAGG + Intergenic
1015618481 6:135104680-135104702 ATGTGTAGAAAAAAGCTGGATGG - Intergenic
1017122648 6:151038991-151039013 CTTCAAAGAAAGAGGCAGGAAGG + Intronic
1017213287 6:151880508-151880530 AAGGACAGAAAAAGGCAGGCAGG + Intronic
1017578389 6:155832396-155832418 AAGCAAAGAAAAAAGGAGGAAGG - Intergenic
1017761028 6:157568365-157568387 ATGCAGAGAAAAAAACTGGAAGG - Intronic
1018180659 6:161220671-161220693 AAACATAGAGAAAGGCAGAAGGG - Intronic
1019169952 6:170128011-170128033 ATGCATAGGAAAAGTCTGCAAGG + Intergenic
1019244195 6:170696784-170696806 ATGCATGGAAAAAGAAAGGTAGG - Intergenic
1020740683 7:12012774-12012796 TGGCAAAGAAAAAGGTAGGAAGG - Intergenic
1021107458 7:16654256-16654278 AAGCTTAGAAAAAAGCAAGATGG - Intronic
1021278936 7:18692530-18692552 ATGCACAGAAAAAGGAAAGACGG - Intronic
1021785814 7:24151501-24151523 AAGCACAGAGAAGGGCAGGATGG - Intergenic
1021959800 7:25859874-25859896 AGGAAAAGAAAAAGGAAGGAAGG + Intergenic
1022280684 7:28906184-28906206 ATACATAGAAAAATTCAGGAAGG + Intergenic
1022514647 7:30967713-30967735 CTGCATAAAAAAAGGAAGGAGGG - Intronic
1024292895 7:47818263-47818285 ATGCAGTGAAAAGGGCGGGAGGG + Intronic
1024981785 7:55163345-55163367 AGTGATAGAAAAAGGAAGGAGGG - Intronic
1025307777 7:57879587-57879609 ATTCACAGAGAAAGGCAGGAAGG - Intergenic
1025488134 7:61077427-61077449 AGGAATGGAGAAAGGCAGGAAGG - Intergenic
1025924950 7:65950825-65950847 ATGCATAGAAAAGGGTCGGGTGG + Intronic
1026260883 7:68754276-68754298 AAGGAAAGAAAAAGGAAGGAAGG + Intergenic
1026526964 7:71162160-71162182 AGGCATAGCAACAGGAAGGAAGG - Intronic
1027234565 7:76290476-76290498 AAGAAAAGAAAAAAGCAGGAGGG - Intergenic
1027778828 7:82498744-82498766 AAGAATAGAAAAACGCAGGCTGG + Intergenic
1027997292 7:85440254-85440276 ATGTATAGAAATTGGTAGGAAGG + Intergenic
1028642037 7:93053372-93053394 ATGCATAGAAAATGACCCGAAGG + Intergenic
1028645640 7:93093625-93093647 AGGCATTGAAGAAGGTAGGAAGG - Intergenic
1029171170 7:98630028-98630050 AGGCATTGAAATAGGAAGGATGG - Intergenic
1029729582 7:102430613-102430635 AAGGAAAGAAAAAGGGAGGAAGG + Intergenic
1030745231 7:113157436-113157458 ATGCTTAGAAAAAGTCTAGAAGG - Intergenic
1031650071 7:124277408-124277430 AAGAATAGGAACAGGCAGGAGGG + Intergenic
1031844115 7:126783514-126783536 AAGCTTAGAAAAAAGCAGGTAGG - Intronic
1032231728 7:130080241-130080263 ATGCATAGAAAAAGAAAGGAAGG - Intronic
1032311640 7:130792924-130792946 GTGCAGAGAAAATGGAAGGAAGG - Intergenic
1032790944 7:135242063-135242085 AAGGAAAGAAAAAGGAAGGAAGG + Intronic
1033425144 7:141237547-141237569 ATACATAGAAAAGGGCTGCAAGG + Intronic
1033736097 7:144223211-144223233 ATACATAGAGAAAGTAAGGAAGG + Intergenic
1033746956 7:144327741-144327763 ATACATAGAGAAAGTAAGGAAGG - Intergenic
1033882243 7:145900250-145900272 CTTCATAGAAAAATACAGGAAGG - Intergenic
1033994624 7:147330315-147330337 ATGCATAGGAAAAGGCATGATGG - Intronic
1034135211 7:148761734-148761756 ATTTACAGAAAAAGGCAGGCAGG + Intronic
1034692239 7:153023126-153023148 ATTGATAGAGAAAGGCAAGAGGG - Intergenic
1034727907 7:153357394-153357416 ATGCTCAGACAAAGACAGGATGG - Intergenic
1034883616 7:154780886-154780908 ATGAATAGATAAATGCATGATGG + Intronic
1035318629 7:158013989-158014011 ATGCATAGACAAATGATGGATGG - Intronic
1035318674 7:158014181-158014203 ATGCATAGACAAATGACGGATGG - Intronic
1035503928 8:111376-111398 ATGCATGGAAAAAGAAAGGTAGG + Intergenic
1035856975 8:2986034-2986056 CTCCATAGAAGAAGGAAGGAAGG + Intronic
1036614976 8:10381013-10381035 ATGGATAGAAAATGGATGGATGG + Intronic
1037460876 8:19108018-19108040 AAGCATAGAAAAAGGTAAAATGG - Intergenic
1038061517 8:23919033-23919055 ATGCATAGGAAAAAGGAGTAAGG - Intergenic
1040382326 8:46884989-46885011 GTGCAAAGAACTAGGCAGGAGGG + Intergenic
1040583252 8:48715116-48715138 ATGCATTGTAAAAGTCTGGAAGG + Intronic
1041100593 8:54392748-54392770 ATGCAGAGAAGGAGGCAGAAGGG + Intergenic
1041924800 8:63225480-63225502 AAGCATAATAAAAGGCAGTATGG - Intergenic
1042069470 8:64915018-64915040 AGGGAAAGAAAGAGGCAGGAGGG + Intergenic
1042111586 8:65386996-65387018 AGGCATGGGACAAGGCAGGAAGG - Intergenic
1043112152 8:76199888-76199910 TTGCATAAAAACAGCCAGGATGG + Intergenic
1043602034 8:81952502-81952524 ATGGAGAGAAGAAGGCAAGAAGG - Intergenic
1044320491 8:90795448-90795470 ATGCTTAGACGAAGGAAGGAAGG - Intronic
1044570738 8:93715487-93715509 ATGCATAGGAAAAATCTGGAAGG - Intronic
1044585357 8:93864583-93864605 ATGCATAGAAGAAATCTGGAAGG - Intronic
1044799733 8:95941964-95941986 ATGCATAGAAAATGTAAGAATGG - Intergenic
1044900310 8:96937015-96937037 CTGGAAAGAAAAAGGGAGGAAGG - Intronic
1045257081 8:100535061-100535083 ATCCAAAGAAAATGGCAGGCTGG - Intronic
1045526766 8:102947199-102947221 ATGCATAGATAATGTAAGGATGG - Intronic
1045901442 8:107285946-107285968 ATTCAAAGAAAAAGGTAGAAAGG + Intronic
1045950699 8:107848878-107848900 AGGAAGAGAAACAGGCAGGAAGG + Intergenic
1045996954 8:108374196-108374218 ATGCATAGAAAATGTCAGGAAGG - Intronic
1045997113 8:108375954-108375976 ATGGATAGAAAAAATCAGTATGG - Intronic
1046476103 8:114745893-114745915 GTGCATAGAAAAACAGAGGAAGG + Intergenic
1046553384 8:115745330-115745352 ATGCTTAGAAAGATGCAGCATGG - Intronic
1047084086 8:121496957-121496979 AAGCATAAAAAAAGACATGATGG + Intergenic
1047244796 8:123132114-123132136 AGGAATAGAAAAAGCGAGGAAGG - Intronic
1047464616 8:125100317-125100339 AGGCAAAGGAAAAGGCAGGTAGG - Intronic
1048227619 8:132603945-132603967 ATTCATAGAATTAGGAAGGAAGG + Intronic
1048710132 8:137200805-137200827 ATGGGGAGAAAATGGCAGGAAGG - Intergenic
1049035747 8:140074511-140074533 ATGCACAGAAGATGGCAGGGTGG + Intronic
1049109231 8:140633372-140633394 ATTCATAGCTAATGGCAGGATGG - Intronic
1049677047 8:143894673-143894695 AAGCAGAGAGAAAGGCAGGCAGG + Intergenic
1050263328 9:3863888-3863910 GTGGAAAGAAAAAGGGAGGAGGG + Intronic
1050410395 9:5358268-5358290 AAGCATTGAAAAAGCCAGAAAGG - Exonic
1050600710 9:7247286-7247308 GTGCTTAGAACAATGCAGGAGGG + Intergenic
1051400778 9:16679726-16679748 ATGGAGAGGAAAAGGCAGGAAGG + Intronic
1051724436 9:20074540-20074562 AGGAAGAGAAGAAGGCAGGAAGG + Intergenic
1052258529 9:26488231-26488253 CTTCACAGACAAAGGCAGGAAGG - Intergenic
1052593686 9:30531424-30531446 AGGCATAGGATGAGGCAGGAGGG + Intergenic
1053552598 9:39099962-39099984 ATGCAGAGAGAAACGCAGGGGGG - Exonic
1053816714 9:41920121-41920143 ATGCAGAGAGAAACGCAGGGGGG - Exonic
1054106976 9:61063803-61063825 ATGCAGAGAGAAACGCAGGGGGG - Intergenic
1054613881 9:67267322-67267344 ATGCAGAGAGAAACGCAGGGGGG + Intergenic
1054715473 9:68553444-68553466 ATGGGTAGAAGAAGGAAGGAGGG + Intergenic
1054740594 9:68802421-68802443 ATGGATAGAAAATGGATGGATGG + Intronic
1055028036 9:71743273-71743295 ATGCATAGCAGAGGGGAGGAAGG + Intronic
1055234807 9:74107928-74107950 ATGCAAAGTTAAAGTCAGGAAGG - Intergenic
1055401318 9:75927339-75927361 ATAAATTGAAGAAGGCAGGAGGG + Intronic
1055568527 9:77592999-77593021 ATTCCTAGAAAAAGGCATTAAGG + Intronic
1056438388 9:86595758-86595780 ATCCATACATGAAGGCAGGATGG + Intergenic
1056705909 9:88952680-88952702 TTTCATAGAAAAGAGCAGGAAGG + Intergenic
1056756989 9:89388076-89388098 ATGCATAGAAGGAGCCATGATGG + Intronic
1056912109 9:90711065-90711087 GTGCCTATAAAAAGGAAGGAGGG + Intergenic
1057281944 9:93719640-93719662 ATGCATAGAGAAAACCTGGAAGG - Intergenic
1058133342 9:101278485-101278507 ATGCATTGAAAATGGTAGAAAGG + Intronic
1058731879 9:107858259-107858281 ATGCACAGAAAATGGAAGTAAGG + Intergenic
1059224219 9:112656643-112656665 GAGCATAGAAAAAGACAGAAAGG - Intronic
1059826138 9:118030992-118031014 ATGCATAGAAAATGGAAGTGAGG + Intergenic
1059903921 9:118960560-118960582 ATGCAAAGAAAAAGAGAGGAAGG - Intergenic
1060129234 9:121078826-121078848 ATGCATAGCGTAAGGCAGGTGGG + Intronic
1060395936 9:123316583-123316605 GTGCAGAGAAAGAGGAAGGAAGG + Intergenic
1061577698 9:131517785-131517807 GTTCATAGAACAAGGAAGGAGGG + Intronic
1203432293 Un_GL000195v1:102407-102429 ATGCAGAGAAAAAGAGAGAAAGG - Intergenic
1203604384 Un_KI270748v1:46008-46030 ATGCATGGAAAAAGAAAGGTAGG - Intergenic
1185492484 X:528527-528549 AAGAAGAGAAAAAGGAAGGAAGG - Intergenic
1185630926 X:1515205-1515227 AAGAAAAGAAAAAGGCAGGTTGG - Intronic
1185863951 X:3605995-3606017 AGGCATTGATAAAGCCAGGAAGG - Exonic
1186189185 X:7052563-7052585 ATGGAAAGAAAAAGGGAGGGAGG - Intronic
1186217232 X:7313091-7313113 AGGCAGAGAAAAAGGGAGGGAGG - Intronic
1186406377 X:9307627-9307649 ATGCACAGAAAAAAGCACAAAGG + Intergenic
1186845737 X:13529218-13529240 TTACATAGAAGAAGGCAGAAAGG + Intergenic
1187035567 X:15535728-15535750 ATATATAGAAAAAGGAAGGAGGG + Intronic
1187114308 X:16333369-16333391 AGGCAAAGAAGAAAGCAGGAGGG - Intergenic
1187310348 X:18135633-18135655 ATGCATAGAGAACCACAGGAGGG - Intergenic
1187407620 X:19017948-19017970 ATACATAGAAAAAAACAGGGAGG - Intronic
1187576589 X:20562792-20562814 ATTGAGAGAAAAAGACAGGATGG + Intergenic
1187633815 X:21205118-21205140 ATGCATTGAAGAATGCAGGAAGG + Intergenic
1187674119 X:21699021-21699043 ATGCAGAGATAAAGTCAGGGAGG - Intergenic
1187747795 X:22428694-22428716 AAGGATGAAAAAAGGCAGGAAGG - Intergenic
1187837476 X:23448793-23448815 AAAGATAGAAAAAGGAAGGAAGG - Intergenic
1187937217 X:24347533-24347555 ATGCACAGAAAATGGAAGGGAGG + Intergenic
1188819582 X:34757979-34758001 ATGCATAAAAAAGAGCAGTAAGG - Intergenic
1190162374 X:48042375-48042397 ATGCATAGAGCAAGGCATGAGGG + Intronic
1190176513 X:48155235-48155257 AAACATAGCAAAAGGCAGGGTGG + Intergenic
1190181782 X:48198338-48198360 AAACATAGCAAAAGGCAGGGTGG - Intronic
1190203240 X:48381672-48381694 AAACATAGCAAAAGGCAGGGTGG + Intergenic
1190207296 X:48413732-48413754 AAACATAGCAAAAGGCAGGGTGG - Intergenic
1190257898 X:48777593-48777615 AGGAATAGAAGAAGGAAGGAAGG + Intergenic
1190286945 X:48967587-48967609 TGGCATGGAGAAAGGCAGGAGGG - Intronic
1190616501 X:52239323-52239345 ATGCAAAGAAAAGGGGAGTAGGG + Intergenic
1190655969 X:52612398-52612420 AAACATAGCAAAAGGCAGGGTGG - Intergenic
1190667558 X:52708820-52708842 AAACATAGCAAAAGGCAGGGTGG - Intergenic
1190671860 X:52749588-52749610 AAACATAGCAAAAGGCAGGGTGG + Intergenic
1191085196 X:56559477-56559499 ATGAAAAGAAAAAGGAAAGAAGG - Intergenic
1191130414 X:57002568-57002590 ATGCATTGAAGAGGGTAGGAAGG + Intergenic
1192039245 X:67600090-67600112 GTGCATAGAAAAAGCTATGAGGG + Intronic
1192267739 X:69551263-69551285 ATACATAAAAAAAGGTTGGATGG + Intergenic
1192605861 X:72516584-72516606 AAGCAGAGAAAATGGCAGAAAGG - Intronic
1193724107 X:85020313-85020335 ATGCATTGATGAGGGCAGGAGGG + Intronic
1194036007 X:88873173-88873195 ATTCATAGAGAAAGGTAGAATGG + Intergenic
1195096734 X:101509044-101509066 ATACATAGAAAAAGAGAGGGGGG - Intronic
1195281988 X:103345072-103345094 ATGCATAGAAAAAGATTGCAAGG - Intergenic
1195596824 X:106700715-106700737 ATGAATAGAAAAAGTCTGAAAGG - Intronic
1196002511 X:110801843-110801865 ATGCATAGAAAAATGCAATATGG + Intergenic
1196264623 X:113627653-113627675 ATGCAAAGAAAAATGCAGGTAGG - Intergenic
1196670561 X:118362515-118362537 ATGCTCAGCAAAAAGCAGGAAGG - Intronic
1197618923 X:128724893-128724915 AGGCATAGAAAGTGGCAAGAAGG - Intergenic
1197777310 X:130126958-130126980 TTGGATAGATAAAGGGAGGAGGG + Intergenic
1198041741 X:132859699-132859721 ATGAAGAAAAGAAGGCAGGAAGG + Intronic
1198174236 X:134139605-134139627 ATGAAAAGGAAAAGGTAGGATGG + Intergenic
1198234506 X:134724653-134724675 ATGCATGGAAAAAGACTGGGAGG - Intronic
1198311240 X:135426775-135426797 CTACAGAGGAAAAGGCAGGAAGG + Intergenic
1198468735 X:136926631-136926653 ATGCATACAAAAAGAAAGCAAGG - Intergenic
1199052371 X:143252023-143252045 ATGAATGGAACAAGGAAGGAAGG + Intergenic
1199070497 X:143469827-143469849 GGGCTCAGAAAAAGGCAGGAAGG - Intergenic
1200453286 Y:3356046-3356068 CTGCATATAAAAGGGCACGATGG - Intergenic
1200735217 Y:6786819-6786841 ATGCACAAAAAAAGCAAGGAAGG + Intergenic
1200800212 Y:7379938-7379960 AGGCATTGATAAAGCCAGGAAGG + Intergenic
1201633123 Y:16092216-16092238 ATGGAAAGAAAAATGAAGGAAGG + Intergenic
1202386437 Y:24331054-24331076 ATGCATGGAAAAAGGAAGGTAGG - Intergenic
1202484349 Y:25339074-25339096 ATGCATGGAAAAAGGAAGGTAGG + Intergenic