ID: 1142668697

View in Genome Browser
Species Human (GRCh38)
Location 17:1477471-1477493
Sequence TGCGGGGCTGCTGGGGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 440
Summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 404}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668697_1142668711 6 Left 1142668697 17:1477471-1477493 CCCTTGCCCCCAGCAGCCCCGCA 0: 1
1: 0
2: 5
3: 30
4: 404
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668697_1142668709 2 Left 1142668697 17:1477471-1477493 CCCTTGCCCCCAGCAGCCCCGCA 0: 1
1: 0
2: 5
3: 30
4: 404
Right 1142668709 17:1477496-1477518 CCCACTCACGTCAGGAAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 100
1142668697_1142668705 -6 Left 1142668697 17:1477471-1477493 CCCTTGCCCCCAGCAGCCCCGCA 0: 1
1: 0
2: 5
3: 30
4: 404
Right 1142668705 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668697 Original CRISPR TGCGGGGCTGCTGGGGGCAA GGG (reversed) Intronic