ID: 1142668698

View in Genome Browser
Species Human (GRCh38)
Location 17:1477472-1477494
Sequence CTGCGGGGCTGCTGGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 765
Summary {0: 1, 1: 0, 2: 8, 3: 64, 4: 692}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668698_1142668711 5 Left 1142668698 17:1477472-1477494 CCTTGCCCCCAGCAGCCCCGCAG 0: 1
1: 0
2: 8
3: 64
4: 692
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668698_1142668705 -7 Left 1142668698 17:1477472-1477494 CCTTGCCCCCAGCAGCCCCGCAG 0: 1
1: 0
2: 8
3: 64
4: 692
Right 1142668705 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 147
1142668698_1142668709 1 Left 1142668698 17:1477472-1477494 CCTTGCCCCCAGCAGCCCCGCAG 0: 1
1: 0
2: 8
3: 64
4: 692
Right 1142668709 17:1477496-1477518 CCCACTCACGTCAGGAAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668698 Original CRISPR CTGCGGGGCTGCTGGGGGCA AGG (reversed) Intronic