ID: 1142668699

View in Genome Browser
Species Human (GRCh38)
Location 17:1477477-1477499
Sequence TGGGGCTGCGGGGCTGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 948
Summary {0: 1, 1: 2, 2: 11, 3: 101, 4: 833}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668699_1142668712 30 Left 1142668699 17:1477477-1477499 CCCCCAGCAGCCCCGCAGCCCCA 0: 1
1: 2
2: 11
3: 101
4: 833
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668699_1142668711 0 Left 1142668699 17:1477477-1477499 CCCCCAGCAGCCCCGCAGCCCCA 0: 1
1: 2
2: 11
3: 101
4: 833
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668699_1142668709 -4 Left 1142668699 17:1477477-1477499 CCCCCAGCAGCCCCGCAGCCCCA 0: 1
1: 2
2: 11
3: 101
4: 833
Right 1142668709 17:1477496-1477518 CCCACTCACGTCAGGAAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668699 Original CRISPR TGGGGCTGCGGGGCTGCTGG GGG (reversed) Intronic