ID: 1142668700

View in Genome Browser
Species Human (GRCh38)
Location 17:1477478-1477500
Sequence GTGGGGCTGCGGGGCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 829
Summary {0: 1, 1: 0, 2: 6, 3: 89, 4: 733}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668700_1142668709 -5 Left 1142668700 17:1477478-1477500 CCCCAGCAGCCCCGCAGCCCCAC 0: 1
1: 0
2: 6
3: 89
4: 733
Right 1142668709 17:1477496-1477518 CCCACTCACGTCAGGAAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 100
1142668700_1142668712 29 Left 1142668700 17:1477478-1477500 CCCCAGCAGCCCCGCAGCCCCAC 0: 1
1: 0
2: 6
3: 89
4: 733
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668700_1142668711 -1 Left 1142668700 17:1477478-1477500 CCCCAGCAGCCCCGCAGCCCCAC 0: 1
1: 0
2: 6
3: 89
4: 733
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668700 Original CRISPR GTGGGGCTGCGGGGCTGCTG GGG (reversed) Intronic