ID: 1142668701

View in Genome Browser
Species Human (GRCh38)
Location 17:1477479-1477501
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 4, 3: 82, 4: 446}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668701_1142668712 28 Left 1142668701 17:1477479-1477501 CCCAGCAGCCCCGCAGCCCCACT 0: 1
1: 0
2: 4
3: 82
4: 446
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668701_1142668711 -2 Left 1142668701 17:1477479-1477501 CCCAGCAGCCCCGCAGCCCCACT 0: 1
1: 0
2: 4
3: 82
4: 446
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668701_1142668709 -6 Left 1142668701 17:1477479-1477501 CCCAGCAGCCCCGCAGCCCCACT 0: 1
1: 0
2: 4
3: 82
4: 446
Right 1142668709 17:1477496-1477518 CCCACTCACGTCAGGAAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668701 Original CRISPR AGTGGGGCTGCGGGGCTGCT GGG (reversed) Intronic