ID: 1142668702

View in Genome Browser
Species Human (GRCh38)
Location 17:1477480-1477502
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 1, 2: 19, 3: 121, 4: 736}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668702_1142668711 -3 Left 1142668702 17:1477480-1477502 CCAGCAGCCCCGCAGCCCCACTC 0: 1
1: 1
2: 19
3: 121
4: 736
Right 1142668711 17:1477500-1477522 CTCACGTCAGGAAGTGTGGATGG 0: 1
1: 0
2: 0
3: 5
4: 134
1142668702_1142668709 -7 Left 1142668702 17:1477480-1477502 CCAGCAGCCCCGCAGCCCCACTC 0: 1
1: 1
2: 19
3: 121
4: 736
Right 1142668709 17:1477496-1477518 CCCACTCACGTCAGGAAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 100
1142668702_1142668712 27 Left 1142668702 17:1477480-1477502 CCAGCAGCCCCGCAGCCCCACTC 0: 1
1: 1
2: 19
3: 121
4: 736
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668702 Original CRISPR GAGTGGGGCTGCGGGGCTGC TGG (reversed) Intronic