ID: 1142668704

View in Genome Browser
Species Human (GRCh38)
Location 17:1477488-1477510
Sequence CCTGACGTGAGTGGGGCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668704_1142668716 28 Left 1142668704 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1142668716 17:1477539-1477561 CCAGCTTCTCCAGGAAGGTCAGG 0: 1
1: 0
2: 0
3: 48
4: 545
1142668704_1142668712 19 Left 1142668704 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668704_1142668713 23 Left 1142668704 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 165
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668704 Original CRISPR CCTGACGTGAGTGGGGCTGC GGG (reversed) Exonic