ID: 1142668705

View in Genome Browser
Species Human (GRCh38)
Location 17:1477488-1477510
Sequence CCCGCAGCCCCACTCACGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668695_1142668705 25 Left 1142668695 17:1477440-1477462 CCTGCACTCCGCAGGCTCTGCTG 0: 1
1: 0
2: 3
3: 30
4: 248
Right 1142668705 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 147
1142668697_1142668705 -6 Left 1142668697 17:1477471-1477493 CCCTTGCCCCCAGCAGCCCCGCA 0: 1
1: 0
2: 5
3: 30
4: 404
Right 1142668705 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 147
1142668696_1142668705 17 Left 1142668696 17:1477448-1477470 CCGCAGGCTCTGCTGCAAGTGAG 0: 1
1: 0
2: 1
3: 29
4: 295
Right 1142668705 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 147
1142668698_1142668705 -7 Left 1142668698 17:1477472-1477494 CCTTGCCCCCAGCAGCCCCGCAG 0: 1
1: 0
2: 8
3: 64
4: 692
Right 1142668705 17:1477488-1477510 CCCGCAGCCCCACTCACGTCAGG 0: 1
1: 0
2: 1
3: 11
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668705 Original CRISPR CCCGCAGCCCCACTCACGTC AGG Exonic