ID: 1142668706

View in Genome Browser
Species Human (GRCh38)
Location 17:1477489-1477511
Sequence TCCTGACGTGAGTGGGGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142668706_1142668712 18 Left 1142668706 17:1477489-1477511 CCGCAGCCCCACTCACGTCAGGA 0: 1
1: 0
2: 1
3: 18
4: 240
Right 1142668712 17:1477530-1477552 CAGTATCCTCCAGCTTCTCCAGG 0: 1
1: 0
2: 2
3: 26
4: 251
1142668706_1142668716 27 Left 1142668706 17:1477489-1477511 CCGCAGCCCCACTCACGTCAGGA 0: 1
1: 0
2: 1
3: 18
4: 240
Right 1142668716 17:1477539-1477561 CCAGCTTCTCCAGGAAGGTCAGG 0: 1
1: 0
2: 0
3: 48
4: 545
1142668706_1142668713 22 Left 1142668706 17:1477489-1477511 CCGCAGCCCCACTCACGTCAGGA 0: 1
1: 0
2: 1
3: 18
4: 240
Right 1142668713 17:1477534-1477556 ATCCTCCAGCTTCTCCAGGAAGG 0: 1
1: 0
2: 4
3: 34
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142668706 Original CRISPR TCCTGACGTGAGTGGGGCTG CGG (reversed) Exonic